ID: 951858117

View in Genome Browser
Species Human (GRCh38)
Location 3:27220793-27220815
Sequence CACTGTGTGAGACTGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951858117 Original CRISPR CACTGTGTGAGACTGGCATA AGG Intronic
900723750 1:4200417-4200439 GATGGTGTGATACTGGCATAAGG - Intergenic
901250596 1:7776036-7776058 AACAGTGTGATACTGGCATAAGG - Intronic
901433617 1:9233398-9233420 CACTGAGTGGGCCTGGCAGAGGG - Intergenic
901531401 1:9855410-9855432 GACTGGGTGGTACTGGCATAAGG + Intronic
902644755 1:17790628-17790650 CACTCTGTGAGACTGGCATCTGG + Intronic
903062030 1:20675536-20675558 GACTGTGTGGTACTGGCATGAGG - Intronic
903382921 1:22909243-22909265 CACTCTGGGAGACTGGCACAAGG - Intronic
904103261 1:28052348-28052370 GACCGTGTGGTACTGGCATAAGG + Intronic
904668764 1:32145793-32145815 AACAGTGTGGTACTGGCATAAGG - Intronic
906111634 1:43327085-43327107 GACGGTGTGGTACTGGCATAAGG + Intergenic
908634715 1:66150120-66150142 GACAGTGTGATACTAGCATAAGG - Intronic
910776060 1:90876335-90876357 CACAGAGTGGTACTGGCATAAGG - Intergenic
912585088 1:110755406-110755428 AACTGTGTGGCACTGGAATAAGG - Intergenic
913395712 1:118369533-118369555 GACTGTGTGTTACTGGCATAAGG - Intergenic
916416885 1:164600640-164600662 CACTGTGTTAAACAGGCATGGGG - Intronic
916709019 1:167385442-167385464 GACAGTGTAATACTGGCATATGG + Intronic
921166497 1:212511673-212511695 CACTGTCTGGCACTGGCAAAGGG + Intergenic
921341071 1:214135286-214135308 GACTGTGTGATATTGGCAGAGGG - Intergenic
921778951 1:219138218-219138240 AACAGTGTGGTACTGGCATAAGG + Intergenic
922538087 1:226397789-226397811 CACAGTGTGGTACTGGCAAAAGG + Intronic
1065070436 10:22018668-22018690 AACAGTGTGGTACTGGCATAAGG + Intergenic
1065436017 10:25704588-25704610 GACAGTGTAAGACTGGCATCTGG - Intergenic
1065480819 10:26192451-26192473 CACTGCGTGAGGCTGGTACAAGG + Intronic
1065750331 10:28880016-28880038 CACTGAGTGAGGCTGGGAGAGGG + Intronic
1067047647 10:42993569-42993591 AACAGTGTAAAACTGGCATAGGG + Intergenic
1067253011 10:44605020-44605042 GACAGTGTGATACTGGCATAAGG - Intergenic
1067398362 10:45945633-45945655 GACTGTGTGGTACTGGCACAAGG + Intergenic
1067778682 10:49181485-49181507 GACTGTGTGGGATTGGCAGAAGG + Intronic
1067866675 10:49914718-49914740 GACTGTGTGGTACTGGCACAAGG + Intronic
1068971346 10:62961508-62961530 GACTGTGTGAGACCGGGAGAGGG - Intergenic
1070084197 10:73219532-73219554 GGTTGTGTGAAACTGGCATAAGG + Intronic
1070719276 10:78745129-78745151 CACTGAGGGAGACTGGAAGAAGG - Intergenic
1070758037 10:79005638-79005660 GACTGTGGGAGCCTGTCATAAGG + Intergenic
1071030110 10:81168117-81168139 GACTGTGTGGTACTGCCATAAGG - Intergenic
1071233341 10:83615193-83615215 GACTCTGTGAGACTGGGACAAGG - Intergenic
1072297225 10:94021613-94021635 GACAATGTGATACTGGCATAAGG - Intronic
1072778605 10:98226689-98226711 AACAGTGTGGCACTGGCATAAGG + Intronic
1072981829 10:100104864-100104886 AACTGTGTGATATTGGCATAAGG - Intergenic
1073389323 10:103160020-103160042 GACTGTGTGCTACTGGCATAAGG + Intronic
1075401787 10:122166209-122166231 CCCTGTGAAAGACTGGCTTAAGG + Intronic
1076448347 10:130535084-130535106 AACAGTGTGATACTGGCATAAGG - Intergenic
1077436782 11:2543955-2543977 CCCAGTGTGTGACTGGCAAAAGG - Intronic
1079127527 11:17729345-17729367 GACTGTGTGGTATTGGCATAAGG - Intergenic
1080042473 11:27773416-27773438 CAGTGTATGAGAATGGAATAAGG - Intergenic
1080638477 11:34143814-34143836 CACTGGCTGAGACTTGCTTATGG + Intronic
1081069436 11:38592934-38592956 CACTGTGGTATACTGGCAAAGGG - Intergenic
1081725671 11:45326749-45326771 AACAGTGTGATATTGGCATAGGG - Intergenic
1081943131 11:46962302-46962324 GACTGTGTGGTACTGGCATAAGG - Intronic
1082080964 11:48012349-48012371 CACTTTGGGTGACTGGAATATGG - Intronic
1085139952 11:74130710-74130732 GTCAGTGTGATACTGGCATAAGG - Intronic
1085218022 11:74849307-74849329 AACTCTGTGAGACAGGCACAAGG - Intronic
1085835052 11:79946320-79946342 CAGAGTGTGGTACTGGCATAGGG + Intergenic
1086029061 11:82331519-82331541 CACTGTGTGGTACTGGCAGAAGG + Intergenic
1086073730 11:82827628-82827650 TACAGTGTGATACTGGCATAAGG - Intronic
1086446609 11:86877697-86877719 GACTGTATGGCACTGGCATAAGG - Intronic
1087003800 11:93448465-93448487 GATTGTGTGGTACTGGCATAAGG - Intergenic
1087854330 11:103073545-103073567 GACTGTGTGGTACTGGCAGAAGG + Intronic
1087906016 11:103698613-103698635 GACTGTGTGGTACTGGTATAAGG - Intergenic
1088865481 11:113843750-113843772 GACTGTGTGCTGCTGGCATAAGG + Intronic
1089851796 11:121503751-121503773 GACAGTGTGATGCTGGCATAGGG - Intronic
1090305167 11:125685045-125685067 CACTGTGTGAGCCAGGAATCAGG + Intergenic
1090585883 11:128212551-128212573 CACACTGTGAGCCTGACATATGG - Intergenic
1091040295 11:132272246-132272268 CAGACTGTGATACTGGCATAAGG - Intronic
1091210785 11:133856824-133856846 GACAGTGTGGTACTGGCATAAGG - Intergenic
1091508037 12:1092848-1092870 CTCTTTGTGAGGCTGGCACATGG + Intronic
1092478953 12:8843009-8843031 CACTGCCTGAGAATGGCATGTGG - Intronic
1092575793 12:9781713-9781735 CACTCTGGGAGGCTGGTATAGGG + Intergenic
1092805401 12:12217659-12217681 GACAGTGTGATACTAGCATAAGG + Intronic
1095570012 12:43674439-43674461 GACAGTGTGGTACTGGCATAAGG + Intergenic
1096237000 12:49936017-49936039 GACTGTGTGTAACTGGCATAAGG - Intergenic
1096345898 12:50846506-50846528 GAGTGTGTGATACTAGCATAAGG - Intronic
1096671571 12:53201919-53201941 GACAGTGTGGTACTGGCATAAGG + Intronic
1096842734 12:54389439-54389461 CACTCTGTGGGCTTGGCATAAGG + Intronic
1096976200 12:55700454-55700476 CACTGAGTTAGACAGGCACACGG + Intronic
1101622732 12:106405095-106405117 AACAGTGTGATACTGGCACAAGG - Intronic
1101890248 12:108707311-108707333 GACTGTGTGGTACTGGAATAAGG + Intronic
1103253550 12:119521654-119521676 CACAGAGTGAGACAGGCAGACGG + Intronic
1104723894 12:131063635-131063657 GACTGTGTGGGACTGGCACAGGG - Intronic
1105788602 13:23774276-23774298 GACTGTGTGGTGCTGGCATAAGG - Intronic
1106288572 13:28339886-28339908 TCCTGAGTGAGACTGGAATAAGG + Intronic
1106289134 13:28344281-28344303 CACAGTGAGAGACTGACAGAAGG - Intronic
1106674047 13:31938675-31938697 GACAGTGTGGTACTGGCATAAGG - Intergenic
1107195605 13:37647708-37647730 CACTTTGTGAAACTAGCACATGG - Intronic
1107378165 13:39827231-39827253 AACAGTGTGATATTGGCATAGGG + Intergenic
1107918035 13:45172809-45172831 GACTGTGTGGTACTGGCATGAGG - Intronic
1108371224 13:49770942-49770964 GACTGTGTGATACTGGCATAAGG - Intronic
1108427834 13:50322908-50322930 TACAGTGTGGCACTGGCATAAGG - Intronic
1108516393 13:51206860-51206882 CACTGTGTTAGACTAACACAAGG - Intergenic
1109117899 13:58412499-58412521 GACTGTGTGATATTTGCATAAGG + Intergenic
1111489076 13:88945711-88945733 CACTCTGTGAGGATGGAATATGG - Intergenic
1113265646 13:108614597-108614619 AACAATGTGATACTGGCATAAGG + Intronic
1114082766 14:19215905-19215927 CACTGTGGGAACCTGGCTTATGG + Intergenic
1114625845 14:24129753-24129775 CACTGTGTGAGACCAGCTCAAGG + Intronic
1114768971 14:25407487-25407509 AACTGTGTGATAATGTCATAGGG - Intergenic
1115181870 14:30636595-30636617 CACTGTGTGGTACAGGCATAAGG - Intronic
1115660501 14:35489711-35489733 AACAGTGTGTTACTGGCATAAGG - Intergenic
1115860179 14:37676927-37676949 AACAGTGTGATACTAGCATAAGG - Intronic
1117515623 14:56498491-56498513 GACTGTGTGGTGCTGGCATAAGG - Intronic
1118532636 14:66724149-66724171 CAATTTGTGATTCTGGCATATGG + Intronic
1118561870 14:67093913-67093935 CACTGTCTGAGACTGCAAGAAGG - Intronic
1118628484 14:67680895-67680917 GATAGTGTGATACTGGCATAAGG + Intronic
1118884664 14:69856327-69856349 CACTGTGTGAGGCTGGAGTCTGG + Intronic
1119184651 14:72631421-72631443 CTCTCTGAGAGACTGGAATAGGG - Intronic
1119493374 14:75057619-75057641 GACAGTGTGGTACTGGCATAAGG + Intronic
1119837809 14:77766509-77766531 GACAGTGTGGTACTGGCATAAGG + Intronic
1120784869 14:88524250-88524272 AACTGTGTGGTACTGGCATAAGG + Intronic
1120792081 14:88593499-88593521 GACTGTGTGGTACTGGCATAAGG + Intronic
1120806509 14:88757099-88757121 GACAGTGTGGTACTGGCATAAGG + Intronic
1121025445 14:90612695-90612717 AACTGTGTGAGGATGACATAAGG + Intronic
1121053581 14:90835687-90835709 GACAGTGTGATACTGACATAAGG - Intergenic
1124176721 15:27432883-27432905 AACTGTGTTAGACTGTCATGTGG - Intronic
1124245138 15:28062922-28062944 GACTGTGTGTTTCTGGCATAAGG - Intronic
1125291235 15:38149854-38149876 GACAGTATGATACTGGCATAAGG - Intergenic
1126019490 15:44386400-44386422 AACAGTATGATACTGGCATAAGG - Intronic
1127299725 15:57641074-57641096 CACAGTTAGAGACTCGCATAGGG - Intronic
1129595004 15:76956197-76956219 CATGGTGTGGTACTGGCATAAGG + Intergenic
1129614193 15:77084813-77084835 AACTGTGTGACCCTGGCCTAGGG + Intergenic
1130583858 15:85163897-85163919 AACAGTGTGGTACTGGCATAAGG + Intergenic
1133332702 16:4985699-4985721 AACAGTGTGATACTGGCATAAGG - Intronic
1136033755 16:27522469-27522491 GACAGTGTGATACTGGCACAAGG - Intronic
1136789586 16:32958320-32958342 AACAGTGTGGTACTGGCATAAGG + Intergenic
1136880226 16:33895613-33895635 AACAGTGTGGTACTGGCATAAGG - Intergenic
1137483902 16:48875952-48875974 CCCTGTGTGAGTCAGGCAGAGGG - Intergenic
1137987930 16:53126421-53126443 GACAGTGTGGAACTGGCATAAGG - Intronic
1138518402 16:57553547-57553569 GACAGTGTGTTACTGGCATAAGG - Intronic
1139732502 16:68958684-68958706 CACTGTGGGAGACTGAGATGGGG + Intronic
1140097627 16:71888640-71888662 GACTGTATGATAGTGGCATAAGG - Intronic
1140193265 16:72836197-72836219 CACAGAGGGAGAATGGCATAGGG - Intronic
1140934373 16:79656945-79656967 CACTGTATGAACCTGGCATGTGG + Intergenic
1203091788 16_KI270728v1_random:1219788-1219810 AACAGTGTGGTACTGGCATAAGG + Intergenic
1143431781 17:6893516-6893538 CAGGGTGTGAAACTGGCATCAGG + Intronic
1145023713 17:19452221-19452243 CACTGGCTGGGACTGGCAGAAGG + Intergenic
1145843386 17:28015764-28015786 AACTGTATGGTACTGGCATAAGG - Intergenic
1147151841 17:38520965-38520987 AACAGTGTGGTACTGGCATAAGG + Intergenic
1147232734 17:39030883-39030905 CACTGGGTGATACTGGAATCTGG - Intergenic
1147501578 17:40969579-40969601 AACAGTGTGATATTGGCATAAGG + Intergenic
1147725514 17:42564181-42564203 CCCTGAGGGAGACTGGCAGAGGG + Intronic
1148172174 17:45530860-45530882 CACAGTGTGATACTGGAATGTGG + Intergenic
1148363754 17:47036707-47036729 CACAGTGTGATACTGGAATGTGG - Intronic
1149977058 17:61276827-61276849 GACAGTGTGGTACTGGCATAAGG + Intronic
1150096093 17:62376974-62376996 CAGTGTCTAAGAATGGCATAGGG + Intronic
1150403377 17:64877778-64877800 CACAGTGTGATACTGGAATGTGG + Intronic
1150451758 17:65274750-65274772 GACTGTGTGATACGGGCACAAGG + Intergenic
1151110779 17:71675375-71675397 GACTGTCTGAGGCTGGCACAAGG - Intergenic
1151141335 17:71995277-71995299 CACTGTGTAAGACCTGCATCAGG - Intergenic
1156255673 18:35393950-35393972 AACTATGTGGTACTGGCATAAGG - Intergenic
1156869206 18:41925817-41925839 GACAGTGTGGTACTGGCATAAGG + Intergenic
1156933763 18:42677737-42677759 CAGTGTGTGAGACGGCCTTAAGG - Intergenic
1156957442 18:42985524-42985546 GACAGTGTGATACTGGCACATGG + Intronic
1157734163 18:50031789-50031811 CACTGTTTGAGAAATGCATAGGG - Intronic
1158823252 18:61185384-61185406 CAATGTGAAAGACTGGAATAAGG - Intergenic
1159205227 18:65242286-65242308 TAATCTGTGAGACTGGCATAAGG - Intergenic
1159578861 18:70212143-70212165 AACAGTGTGATACTGGTATAAGG + Intergenic
1160170771 18:76552081-76552103 TACAGTGTGGTACTGGCATAAGG + Intergenic
1160328382 18:77970069-77970091 GGCTGTCTGTGACTGGCATAGGG + Intergenic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1165398500 19:35581997-35582019 GACAGTGTGGTACTGGCATAAGG + Intergenic
1167123713 19:47534712-47534734 AACAGTGTGATACTGGCATAAGG + Intronic
1167392597 19:49205940-49205962 AACTGTGTGGTTCTGGCATAAGG - Intronic
1168466675 19:56607888-56607910 CACTGTGTGAGGCTCTCAGAAGG - Intronic
926002161 2:9342287-9342309 GACAGTGTGGTACTGGCATAAGG + Intronic
926129659 2:10294549-10294571 GACGGTGTGGTACTGGCATAAGG - Intergenic
928004562 2:27552458-27552480 AACAGTGTGGTACTGGCATAAGG - Intronic
928414849 2:31083594-31083616 CACTGCGTGAGTCTGGCACAAGG + Intronic
928901941 2:36328817-36328839 AAGAGTGTGATACTGGCATAAGG + Intergenic
928902078 2:36330517-36330539 AAGAGTGTGATACTGGCATAAGG + Intergenic
929713731 2:44290297-44290319 CAGTGTGTGGTACTGACATAAGG - Intronic
930024091 2:47020018-47020040 CACTGTGTGGTGCTGACATAGGG - Intronic
931560255 2:63554045-63554067 CAATGGGTGAAACTGGCATTTGG - Intronic
932752146 2:74378108-74378130 CACTGTTTGCCACTGGCAAATGG - Exonic
933053803 2:77635132-77635154 GACAGTGAGATACTGGCATATGG - Intergenic
935683583 2:105661575-105661597 GATGGTGTGATACTGGCATAAGG - Intergenic
936335462 2:111585313-111585335 GACTGTGTGAGACGGGGATGGGG - Intergenic
938151279 2:128886238-128886260 AACAGTGTGGTACTGGCATAAGG - Intergenic
938493812 2:131780712-131780734 CACTGTGGGAACCTGGCTTATGG - Intergenic
938707726 2:133947328-133947350 GATTGTGTGGTACTGGCATAAGG + Intergenic
940346819 2:152637134-152637156 CCCTGTGTGAGGCTGTCATAGGG + Intronic
941178770 2:162234072-162234094 GACAGTGTGTTACTGGCATAAGG - Intronic
943155096 2:184165817-184165839 CACTATGTGACACTTGCATGTGG + Intergenic
943159342 2:184226952-184226974 CACTGTTTCATACTGCCATATGG - Intergenic
944245561 2:197526866-197526888 CACTGTGTGATACTGGCATAAGG - Intronic
947911792 2:233805699-233805721 GACAGTGAGATACTGGCATAAGG + Intronic
948120746 2:235528506-235528528 CAGTGTGTGGGAGTTGCATATGG + Intronic
1168867567 20:1101188-1101210 GACTATGTGGTACTGGCATAAGG - Intergenic
1169371113 20:5028762-5028784 AGCAGTGTGATACTGGCATAAGG - Intergenic
1170054344 20:12182997-12183019 GACTGTGTGAAGCTAGCATAAGG - Intergenic
1171301838 20:24068677-24068699 CACAATGTGGAACTGGCATAAGG - Intergenic
1172577024 20:36017365-36017387 CACAGGGGGAGAATGGCATAAGG - Intronic
1173230046 20:41187638-41187660 AACAGTGTGGTACTGGCATAAGG - Intronic
1173500956 20:43553070-43553092 AACAGTGTGTTACTGGCATAAGG + Intronic
1173964889 20:47105104-47105126 GACAGTGTGGTACTGGCATAAGG - Intronic
1175223671 20:57432635-57432657 CAGTGTGTGTGGCTGGCCTAGGG - Intergenic
1176711092 21:10150225-10150247 CACTGTGGGAACCTGGCTTATGG - Intergenic
1177585967 21:23095918-23095940 CACTTTGTGAGAGTGGAAAATGG + Intergenic
1178220937 21:30659225-30659247 AACTATGTGATACTGACATAAGG + Intergenic
1178982529 21:37276862-37276884 CACAAAGTGAGACTGGCAAAAGG + Intergenic
1179308438 21:40175916-40175938 CCTTGTGTGTGTCTGGCATAAGG - Intronic
1179840203 21:44067580-44067602 CACTGTGGGAGACAGGGATGGGG + Intronic
1180498013 22:15906764-15906786 CACTGTGGGAACCTGGCTTATGG - Intergenic
1181389762 22:22571680-22571702 CACTGTGGGAGAATGGCTTGAGG + Intergenic
1184494711 22:44831825-44831847 GATTGTGTGGCACTGGCATAAGG - Intronic
1185364019 22:50427273-50427295 AACAGTGCGACACTGGCATAAGG - Intronic
949316378 3:2760553-2760575 CACAGTGTGGTACTGGCCTAGGG - Intronic
949339678 3:3015713-3015735 CACTGTGTGTGAATGGCACTTGG + Intronic
949418732 3:3841761-3841783 CACTGTGGGAGGCTGGCAGGGGG - Intronic
949586444 3:5443531-5443553 GACAGTATGACACTGGCATAAGG - Intergenic
950338186 3:12217035-12217057 GACTGTGTGGTATTGGCATATGG + Intergenic
951858117 3:27220793-27220815 CACTGTGTGAGACTGGCATAAGG + Intronic
953138167 3:40201727-40201749 CACTGTGTGACACTGACCAAGGG + Intronic
954259183 3:49426293-49426315 CACTGTGTGGGTCAGGCATTAGG + Exonic
955495353 3:59525805-59525827 AACAGTGTGGTACTGGCATACGG + Intergenic
955569085 3:60284259-60284281 CAATGTGTGACATTGGCAAATGG + Intronic
956261381 3:67346325-67346347 GACAGTGTGGTACTGGCATAAGG + Intergenic
960634815 3:119774052-119774074 GACAGTGTGATATTGGCATAAGG + Intergenic
960652542 3:119967526-119967548 GACAGTGTGGTACTGGCATAAGG + Intronic
961113758 3:124310536-124310558 GACAATGTGATACTGGCATAAGG + Intronic
961423076 3:126822436-126822458 GACAGTGTGGTACTGGCATAAGG - Intronic
961915655 3:130371446-130371468 GACTATGTGATACTGGCATAAGG + Intronic
962044843 3:131745762-131745784 GACTGTGTGGAACTGGCAGAAGG - Intronic
962359049 3:134720844-134720866 TACTGTGTGGTACTGGCATAAGG - Intronic
962534990 3:136320067-136320089 AACAGTGTGACACTGGAATATGG - Intronic
963823712 3:149928536-149928558 AATAGTGTGGGACTGGCATAAGG - Intronic
964725624 3:159811652-159811674 GACTGTGTGGTACTGGCATAAGG - Intronic
965037661 3:163462631-163462653 GACAGTGTGGTACTGGCATAAGG - Intergenic
965047078 3:163593000-163593022 CACCTTGTGAGACTGGAATCTGG + Intergenic
965789531 3:172372796-172372818 CACAGTAAGAGCCTGGCATATGG - Intronic
966767960 3:183479282-183479304 CACTGTTTGCTCCTGGCATAAGG + Intergenic
966844734 3:184119672-184119694 GATAGTGTGATACTGGCATAAGG + Intergenic
967794656 3:193586725-193586747 GACTGTGTGGTATTGGCATAAGG - Intronic
968890503 4:3366227-3366249 CAAAGGGTCAGACTGGCATATGG + Intronic
970834278 4:20382922-20382944 CACAGTGTGGCTCTGGCATAAGG + Intronic
971291094 4:25340363-25340385 GACTGTGTAAGAGTGGCATAGGG - Intronic
971395489 4:26223221-26223243 CACTCTTTGAGACTGGAATGAGG + Intronic
974360931 4:60878155-60878177 GACAGTGTGATATTGGCATAAGG + Intergenic
974619842 4:64340767-64340789 CAGTCTGTGAGACTGGCAGCTGG - Intronic
975665832 4:76733961-76733983 CACTGGGTGAGATTTCCATAGGG - Intronic
976907034 4:90250579-90250601 GACACTGTGATACTGGCATAAGG - Intronic
978752596 4:112268357-112268379 AACTGTCTGATTCTGGCATAAGG + Exonic
981513696 4:145584813-145584835 CACTGCCTGAGACAGGCATCAGG - Intergenic
981773150 4:148333606-148333628 GACTGTGTGGGACTAGCATGTGG - Intronic
982107907 4:152026608-152026630 GAGTGTGTCATACTGGCATAAGG + Intergenic
982137347 4:152284356-152284378 CCCTGTGTGTCACTGGCTTATGG + Intergenic
983484875 4:168321641-168321663 CTCTGTGTGAGACTGGAATATGG - Intergenic
983695585 4:170525691-170525713 AACAGTGTGGTACTGGCATAAGG + Intergenic
983922637 4:173362849-173362871 CACTTTGGGAGGCTGGCAGATGG + Intergenic
985079473 4:186249482-186249504 GACTGTGTGTAACTGGCATTAGG - Intronic
986137563 5:4996466-4996488 GAATGTGTGGTACTGGCATAAGG - Intergenic
987225805 5:15840281-15840303 GACTGTGTGATATTGGCAGAGGG - Intronic
988218237 5:28305764-28305786 GACTATGTGGTACTGGCATAAGG + Intergenic
990362045 5:55030439-55030461 CACAGTGGGAGACTGGCCTTTGG - Exonic
991174122 5:63666652-63666674 AACAGTGTGATACTGGCATAAGG + Intergenic
995439141 5:112170806-112170828 CACTGTGTGTGGCAGGCACATGG - Intronic
996645377 5:125808682-125808704 GACAGTGTGGTACTGGCATATGG + Intergenic
997031200 5:130130878-130130900 CTGTCTGTGAGACTGACATAGGG - Intronic
997556786 5:134806282-134806304 CACTCTTTGAGACTGGGATTAGG + Intronic
997567771 5:134902868-134902890 CACTGTATGAAACTGGCATCTGG - Intergenic
997752862 5:136365532-136365554 ATCTGTGTGAGAGTGGCATGCGG + Exonic
998062413 5:139129218-139129240 CAAAGGGTGATACTGGCATAAGG + Intronic
998234205 5:140383864-140383886 CAGTGTGTGGTACTGTCATAAGG + Intergenic
998238446 5:140420696-140420718 GACAGTGTGGAACTGGCATAGGG - Intronic
999442076 5:151609676-151609698 GACAGTGTGATACTGACATAAGG - Intergenic
1002902513 6:1421525-1421547 GACAGTGTGGTACTGGCATAAGG - Intergenic
1002962975 6:1934246-1934268 GACTGTGTGGTACTGTCATAAGG - Intronic
1003518510 6:6837422-6837444 CACTGTGTGGGATTCGAATATGG - Intergenic
1003526342 6:6900977-6900999 TACTATGTAAGACTGGCATTGGG - Intergenic
1004972861 6:20931174-20931196 CACTGTTTTATACTGACATATGG + Intronic
1006330371 6:33386026-33386048 CATTGTGTGATATTGGCACACGG + Intergenic
1006649626 6:35540397-35540419 AACTGTGTGGTACTGACATAAGG - Intergenic
1007058234 6:38910332-38910354 CACTGTGTAAGATTGACAAATGG + Intronic
1007334536 6:41143838-41143860 GACTGTATGGTACTGGCATAAGG - Intergenic
1007639252 6:43324213-43324235 AACAGTGTGGGACTGGCATAAGG + Intronic
1008550984 6:52630324-52630346 GACTGTGTGGTACTGGCATAAGG + Intergenic
1010964171 6:82184072-82184094 GATTGTGTGATACTGGCATAAGG + Intronic
1012929461 6:105301870-105301892 CACAGTTTGAGACTGGGAAAAGG - Intronic
1014723199 6:124943830-124943852 GACAGTGTGATACTGGCATAAGG - Intergenic
1015237033 6:130983380-130983402 CACTCTGTGATGCTGGCACAAGG - Intronic
1015770948 6:136767810-136767832 GACTATGTGGTACTGGCATAAGG + Intronic
1015772162 6:136779990-136780012 CACTTGGAGAGACAGGCATAGGG + Intronic
1016793206 6:148088827-148088849 GACTCTGTGATACTGACATAAGG - Intergenic
1017501982 6:155034083-155034105 CACTGTTTGACAGTGGGATAAGG - Intronic
1017586206 6:155926995-155927017 CAGTGTGTGATAATGGCACAAGG - Intergenic
1018087574 6:160317629-160317651 AACAATGTGATACTGGCATATGG - Intergenic
1019017508 6:168890643-168890665 CACTCTGAGAGACGGGCCTAAGG - Intergenic
1020064777 7:5179148-5179170 GACAGTGTGGTACTGGCATAAGG + Intergenic
1020214036 7:6175504-6175526 GACATTGTAAGACTGGCATAAGG - Intronic
1020776552 7:12461304-12461326 AACAGTGTGGCACTGGCATAAGG + Intergenic
1021357066 7:19663135-19663157 AACAATGTGATACTGGCATAAGG + Intergenic
1021835710 7:24671908-24671930 GACAATGTGGGACTGGCATAAGG - Intronic
1022212557 7:28225759-28225781 GGCCGTGTGAGACTGGCATCAGG + Intergenic
1023420437 7:39973951-39973973 GACTGTGTGGTACTGGCATACGG - Intronic
1023893297 7:44410311-44410333 AACAGTGTGGTACTGGCATAAGG + Intronic
1023917408 7:44600246-44600268 AACAGTGTGGTACTGGCATAAGG + Intergenic
1024121558 7:46246273-46246295 CCTAGTGTGATACTGGCATAAGG - Intergenic
1024480915 7:49861861-49861883 AACAGTGTGGTACTGGCATAAGG - Intronic
1024654713 7:51441615-51441637 GACTGTGTGCTACTAGCATAAGG - Intergenic
1024725612 7:52190343-52190365 GACAGTGTGATACTGGCACAGGG + Intergenic
1026685019 7:72502502-72502524 TACTTTGTGAGAATGGCAGATGG - Intergenic
1028028737 7:85880902-85880924 CACAGTGTGAGACATGCATACGG - Intergenic
1028704873 7:93829987-93830009 CACTGAGGAAGACTGGCTTAAGG + Intronic
1028714972 7:93955371-93955393 AACTTTGGGAGACTGGTATAGGG + Intergenic
1029235745 7:99116968-99116990 AACAGTGTGGTACTGGCATAAGG + Intronic
1031519365 7:122744598-122744620 CACTGTGTGACAGTGGAATTTGG - Intronic
1032774231 7:135093869-135093891 GACTGTGTGGTACTGGCCTAAGG + Intronic
1033291270 7:140085118-140085140 CACTGTGTGACAATGGCGTGGGG - Exonic
1033523963 7:142191618-142191640 GACAGTGTGGTACTGGCATAAGG - Intronic
1033842128 7:145387159-145387181 TAATCTCTGAGACTGGCATAGGG - Intergenic
1034506995 7:151500396-151500418 GACAGTGTGGTACTGGCATAAGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038010803 8:23474544-23474566 CACTGAGGAAGACAGGCATATGG - Intergenic
1039143836 8:34423028-34423050 CACTGTGAGCCACTGGCATCTGG + Intergenic
1040532611 8:48277629-48277651 CACGGTGAGGGACTGGCATCAGG + Intergenic
1041041232 8:53848343-53848365 GACTGTGTGGTACTGGTATAAGG - Intergenic
1041498166 8:58509997-58510019 AACTTTGTGTTACTGGCATAAGG - Intergenic
1042924319 8:73951811-73951833 AACAGTGTGGTACTGGCATAAGG + Intronic
1044594531 8:93945542-93945564 GACTGTGTGATACTGGCATATGG + Intergenic
1045399516 8:101798780-101798802 GACTGTGGGATACTGGCATAGGG + Intronic
1045894565 8:107199136-107199158 AATAGTGTGATACTGGCATAAGG - Intergenic
1047259799 8:123245326-123245348 AACAGTGTGGTACTGGCATAAGG + Intronic
1048004075 8:130404415-130404437 GACAGTGTGGTACTGGCATAAGG + Intronic
1048219566 8:132528997-132529019 CACTGGGTGAGCCTGGCAGGCGG - Intergenic
1048559889 8:135523025-135523047 GACAGTGTGGTACTGGCATAAGG - Intronic
1049049027 8:140177514-140177536 CACAGTGTGATATTGGCATAAGG - Intronic
1050384550 9:5073492-5073514 CCCTGTGTAAGCCTGGAATATGG - Intronic
1051096183 9:13468171-13468193 GACTGTTTGGTACTGGCATAAGG + Intergenic
1051427565 9:16948829-16948851 GACAGTGTGGTACTGGCATAAGG - Intergenic
1051983449 9:23052640-23052662 GACAGTGTGGTACTGGCATAGGG + Intergenic
1052637861 9:31125650-31125672 GACTGTCTGAGACCGGCACATGG + Intergenic
1052776956 9:32741906-32741928 TACTGTGTGAGATTGGCATTTGG + Intergenic
1053168832 9:35863914-35863936 CACTGCGTGACACTGGTAGATGG - Intergenic
1053439153 9:38101394-38101416 GACTGTTTGATACTGGCATAAGG + Intergenic
1053648087 9:40135920-40135942 CACTGTGTGAACCTGGCTTATGG - Intergenic
1053757651 9:41327925-41327947 CACTGTGTGAACCTGGCTTATGG + Intergenic
1054329058 9:63733865-63733887 CACTGTGGGAACCTGGCTTATGG - Intergenic
1054536493 9:66240251-66240273 CACTGTGTGAACCTGGCTTATGG + Intergenic
1055555944 9:77473788-77473810 AACAGTGTGGTACTGGCATAAGG + Intronic
1055888041 9:81088504-81088526 GATTGTGTGATACTGGCATAAGG - Intergenic
1055897674 9:81198221-81198243 CACTCTGTGAAACTGTAATAGGG - Intergenic
1056213702 9:84388916-84388938 CACTGGCTGAAACTGGCTTAAGG - Intergenic
1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG + Intronic
1057182181 9:93036178-93036200 CACTGTGTGCCACTAGCATCAGG - Exonic
1057267298 9:93626946-93626968 AACAGTGTGGCACTGGCATAAGG - Intronic
1059529308 9:115021123-115021145 CACTGGGTGAGAGAGGAATAAGG - Exonic
1061769376 9:132906220-132906242 CTCTGAGTGACACTGGCATGTGG - Intronic
1061857194 9:133448840-133448862 CACTGTGTGAGGCTGGACCATGG + Intronic
1062626870 9:137447241-137447263 GACTGTGTGGGACAGGCATGCGG + Intergenic
1062677564 9:137756362-137756384 CACTCGGTGACACTGGTATAAGG - Intronic
1202795848 9_KI270719v1_random:119214-119236 CACTGTGGGAACCTGGCTTATGG - Intergenic
1186049945 X:5581020-5581042 AGCTGTATGATACTGGCATATGG + Intergenic
1186293665 X:8125630-8125652 AACTGTGTGAGATTGGAATATGG + Intergenic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1186945984 X:14568250-14568272 AACAGTGTCATACTGGCATAAGG + Intronic
1187530176 X:20089323-20089345 GACAGTGTGATACTGGCATAAGG - Intronic
1187902203 X:24035591-24035613 AACAGTGTGATACTGGTATAAGG + Intergenic
1187909279 X:24095757-24095779 GATTGTGTGATACTGGCAAAGGG - Intergenic
1189359973 X:40342684-40342706 AACAGTGTGGTACTGGCATAAGG - Intergenic
1192026211 X:67455873-67455895 CACAGTGTGGTTCTGGCATAAGG + Intergenic
1192536368 X:71931733-71931755 AACTATGTGCTACTGGCATAAGG - Intergenic
1194817406 X:98460630-98460652 GACTGTGTGGGATCGGCATAAGG - Intergenic
1195058524 X:101171124-101171146 GACAGTGTGATACTGGCATAAGG + Intergenic
1195608549 X:106836812-106836834 GACATTGTGATACTGGCATAAGG + Intronic
1195736986 X:108021920-108021942 AACAGTGTGATACTGTCATAAGG - Intergenic
1195780353 X:108455850-108455872 TACAGTGTGATACTGGCATAAGG - Intronic
1196128664 X:112128191-112128213 AACAGTGTGGTACTGGCATAAGG + Intergenic
1196383090 X:115115328-115115350 GACAGTGTGATACTGGAATAAGG + Intronic
1198116607 X:133550538-133550560 CACTGTGTGGGAGTGACAGAGGG - Intronic
1198652718 X:138880794-138880816 AACAGTATGATACTGGCATAAGG - Intronic
1201611319 Y:15846070-15846092 CATTGTGGGAAACTGGCTTATGG - Intergenic
1202127986 Y:21585501-21585523 CCCTGTGTGAGACTCCCATGGGG + Intergenic
1202151936 Y:21851434-21851456 CCCTGTGTGAGACAGCCATGGGG - Intergenic