ID: 951858356

View in Genome Browser
Species Human (GRCh38)
Location 3:27223421-27223443
Sequence TTGGATGTGCAGATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951858356_951858361 3 Left 951858356 3:27223421-27223443 CCATTGTCCATCTGCACATCCAA 0: 1
1: 0
2: 0
3: 21
4: 287
Right 951858361 3:27223447-27223469 ATACTCTTCCATCCTTTACATGG 0: 1
1: 0
2: 1
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951858356 Original CRISPR TTGGATGTGCAGATGGACAA TGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
901225785 1:7612253-7612275 ATGGATGGGGAGCTGGACAAGGG + Intronic
902149767 1:14433904-14433926 CTGGATGTGCACATGCACCAGGG + Intergenic
902203552 1:14851472-14851494 TTGCATGTGCAGAGGGCCCATGG + Intronic
902776657 1:18679259-18679281 TTGGAGGTGGAGATGGAAAATGG - Intronic
903067491 1:20708785-20708807 TTGGCACTGCAGATGGCCAATGG + Intronic
903214968 1:21838826-21838848 TTGGACGAGCAGCTGGGCAAAGG + Exonic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
904416931 1:30368728-30368750 TGGGATGTGAAGAGGGAGAAGGG - Intergenic
904770442 1:32878268-32878290 TTGGATGTGCATGTGTGCAAAGG + Intergenic
907293152 1:53430636-53430658 TTTTAGGTACAGATGGACAAAGG - Intergenic
908472592 1:64458845-64458867 ATTGCAGTGCAGATGGACAAAGG + Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
915532264 1:156509522-156509544 TAGGATGGGCAGAAGGACAAGGG + Intergenic
915581521 1:156815919-156815941 AAGGACTTGCAGATGGACAAAGG - Intronic
917334624 1:173914833-173914855 TTGGCTGTGCAGATGTCCACAGG + Exonic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
919922989 1:202177391-202177413 TGGGGTGTGGAGATGGAAAATGG - Intergenic
920175069 1:204095585-204095607 TTTAATCTGCAGATGGACAGAGG - Intronic
923287472 1:232510156-232510178 TTGGCAGTGCAGATGAATAAGGG + Intronic
923366834 1:233270036-233270058 ATGGATGACCAGATGGACAAAGG - Intronic
923615824 1:235536316-235536338 TTGGAAGTGCAGATCCACATTGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1065403284 10:25331493-25331515 TTAGAGGTGAAGATGAACAAGGG + Intronic
1069788961 10:71007218-71007240 TTGGATGGGTAGATGGATGATGG - Intergenic
1070538045 10:77394050-77394072 ATGGATGGGCAGACAGACAATGG + Intronic
1072166075 10:92814289-92814311 TAGTATGTGCAGATGAAAAACGG - Intergenic
1073680339 10:105696594-105696616 TTGGATTTGGGAATGGACAAAGG + Intergenic
1073906660 10:108288744-108288766 TTGGACGTGCAAATGTAAAATGG - Intergenic
1075796940 10:125127351-125127373 TCAGATGTGCAGGTGGACAGTGG - Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1079402108 11:20114158-20114180 CTGGATGTGGAGTTGGAAAAAGG - Intronic
1083538392 11:63492291-63492313 TTGGGCGTGCAGAGGGAGAAGGG - Intergenic
1084772055 11:71349684-71349706 ATGGATGTGCGGCTGAACAAAGG - Intergenic
1086931366 11:92696533-92696555 TGGTATATGCTGATGGACAATGG - Intronic
1087082233 11:94182699-94182721 TTGGATGTGCAGATATGCATAGG + Intergenic
1088790336 11:113220054-113220076 TCTGATGTTCAGATGGAAAAAGG - Intronic
1088983613 11:114886803-114886825 TTGTATGTGTAGGTGGACATTGG - Intergenic
1089554050 11:119305238-119305260 TTGGATGCGAAGACTGACAAAGG - Exonic
1094718655 12:33038744-33038766 TTGGCTTTGGAGATGGAGAAAGG - Intergenic
1097970509 12:65628228-65628250 TGGGATGTGGAGGTGGAGAAAGG - Intergenic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1105483580 13:20803509-20803531 TTGGGAGTGAAGATGGAGAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107743438 13:43479461-43479483 TTGGATATGGAGATGGAGACAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108844606 13:54662202-54662224 TAGCATGTGCAGTTGGAGAAAGG - Intergenic
1109876397 13:68409581-68409603 TTGGACGTGCACATGTGCAATGG + Intergenic
1111447584 13:88369222-88369244 TTGGAGGTGGAGATGTATAAAGG - Intergenic
1111685242 13:91493671-91493693 ATGGAAGAGCAAATGGACAAGGG - Intronic
1111873211 13:93860596-93860618 TTGGATGTGATGATGGACTTGGG + Intronic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1116158867 14:41240770-41240792 TGAAATGTGCAGATGGACTAAGG - Intergenic
1116272637 14:42791480-42791502 GTGGTTGGGCAGATGTACAATGG + Intergenic
1119070980 14:71583927-71583949 TTGTCTGTGCAGCTGAACAAAGG - Intronic
1119782315 14:77284712-77284734 ATGGATCTGCAGATGGCCACTGG + Intronic
1121046459 14:90791705-90791727 TTGGCAGTGCTGATGGAAAATGG + Intronic
1122322747 14:100865531-100865553 TCTGATGGGCAGAAGGACAAAGG - Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1123218546 14:106835334-106835356 TTGGATGTGCTGTTGGACTCAGG + Intergenic
1124559135 15:30755903-30755925 TTGGAGGTGCCGATGCAGAAAGG - Intronic
1124672124 15:31649821-31649843 TTGGAGGTGCTGATGCAGAAAGG + Intronic
1127301126 15:57654927-57654949 TTAAATGTGCAGATTGGCAAGGG + Intronic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127594922 15:60470955-60470977 TTAGATCTGCATCTGGACAAAGG + Intronic
1128776168 15:70322105-70322127 TAGGTTGTGTTGATGGACAATGG - Intergenic
1129012793 15:72438291-72438313 GTGAATGTGAAGAAGGACAATGG - Intergenic
1129105861 15:73306838-73306860 TAAGATGAGCATATGGACAAGGG + Intergenic
1129700446 15:77764924-77764946 GTGGATGTGCAGATGAACCACGG + Intronic
1130866634 15:87938844-87938866 TGAGATGGTCAGATGGACAAGGG - Intronic
1131150129 15:90042572-90042594 TTGGATGATCAGAAGGAAAAAGG + Intronic
1132516013 16:366402-366424 CTGCATGTGCAGAATGACAAGGG - Intergenic
1132562945 16:606724-606746 CTGGCTCTGCAGATGGGCAAGGG - Intronic
1133023113 16:2975510-2975532 CTGGCTGTGCAGATGGGCCAGGG + Exonic
1133838995 16:9391925-9391947 TTTGATGTGGAGCTGGAGAACGG + Intergenic
1137579847 16:49627185-49627207 ATGGATGGGTAGATGGAAAATGG - Intronic
1137580061 16:49628135-49628157 ATGGATGGGTAGATGGACGATGG - Intronic
1137848072 16:51711501-51711523 GTGCATGTGCACATGCACAAAGG - Intergenic
1140452172 16:75079782-75079804 TTGGAGGTGCAGCTGAACAGAGG + Intronic
1141144965 16:81522844-81522866 TTAAATGTGAAGATGCACAAGGG - Intronic
1145262463 17:21362792-21362814 ATGGATGTGCAGATGGATGGAGG + Intergenic
1146792484 17:35760217-35760239 AGGAATGTGTAGATGGACAATGG - Intronic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1146978702 17:37139369-37139391 CTGGAGGTGGAAATGGACAATGG + Intronic
1147424596 17:40340169-40340191 CTGGAAGTGCTGATGGACAGAGG - Intronic
1147668396 17:42163179-42163201 GTGGATGGGCAGATGGATGACGG + Intronic
1148973614 17:51507237-51507259 TTGGATGTCCAGGAGGATAAAGG - Intergenic
1149454997 17:56780563-56780585 TTGGAAGAGCAAATGGACATGGG - Intergenic
1151139509 17:71977981-71978003 TTGGCTTTGAAGATGGAGAAGGG + Intergenic
1152646416 17:81470813-81470835 ATGGATGGGCAGATGGACACAGG - Intergenic
1153327894 18:3840409-3840431 TTGGTTGTGAAGATGGAGAAAGG - Intronic
1156561283 18:38128568-38128590 TTTTATGTGGAGATGGAAAATGG + Intergenic
1157705479 18:49801596-49801618 CTGGATGTGAAGATACACAACGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158435326 18:57431245-57431267 TTACACGTGCAGATGGACAGTGG - Intergenic
1158968257 18:62642614-62642636 TTGGCTTTGAAGATGGAAAAAGG + Intergenic
1159438446 18:68447301-68447323 TGGGATGTGCAGGTGGCCCAGGG + Intergenic
1159792967 18:72806777-72806799 TTGGATGTGAAGATTGATTATGG - Intronic
1159895981 18:73996507-73996529 TTGGACCTGCAGGTGTACAAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161916111 19:7229370-7229392 ATGGATGGGCAGATGAGCAAGGG + Intronic
1162030558 19:7915473-7915495 TGTGGTGTGCGGATGGACAAGGG + Intergenic
1162085944 19:8249187-8249209 TTGGATGGGTGGATGGACGATGG + Intronic
1163747004 19:19054670-19054692 GTGGATGGGCACATGGAGAAGGG - Intronic
1165787133 19:38468372-38468394 TTGGATGGGCAGATGGTTATTGG - Intronic
1165843095 19:38801144-38801166 ATGGATGGGTAGATGGATAAAGG + Intergenic
1166981707 19:46635285-46635307 TCGGATGGACAGAGGGACAACGG + Intergenic
1167214951 19:48158310-48158332 ATGGATGTTCACAGGGACAAGGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167297043 19:48657010-48657032 TTGGCCGTGAAGATGGAAAAAGG + Intergenic
1167824780 19:51962277-51962299 AAGGATGTGCAGATTCACAAAGG + Intergenic
1168336399 19:55599849-55599871 TAGGATGTACAGTTGGACTAGGG + Intronic
1168354357 19:55692365-55692387 TGGGAGGTGCAGGTGGAGAAGGG + Intronic
925745246 2:7038571-7038593 TTGGGTGTTTAGATGGAAAAGGG + Intronic
926436685 2:12845470-12845492 TTGGGTGTGTGGATGGACTAAGG - Intergenic
927011294 2:18907349-18907371 TTGAATGTGTAGATGAACAGGGG + Intergenic
928106119 2:28471637-28471659 TTGGTTGTGGGGATGGAGAAGGG + Intronic
928170532 2:29000249-29000271 TTTGTTGAGCAGATGAACAAGGG + Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
934537874 2:95151301-95151323 TTGGCTTTGAAGATGGACGAGGG + Intronic
934891276 2:98071932-98071954 TTAAATGTGCAAATGGACACAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938323249 2:130379882-130379904 GTGGATGTGAAGAAGGATAAGGG + Intergenic
940772364 2:157852954-157852976 TAGGATGTGGAGATGTTCAAGGG + Intronic
941141756 2:161791605-161791627 TTTGAAGTTCAGATGTACAAGGG - Intronic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
945428737 2:209739437-209739459 TCCCATGTGCAGATGGACACAGG - Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
1169532078 20:6496159-6496181 TTTCAGGTGCAGGTGGACAAGGG - Intergenic
1170435362 20:16321694-16321716 TCAGATGTGCAGAAGGAAAATGG + Intronic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1172179914 20:32996607-32996629 TTGGAAGAACAGATGGATAAGGG - Intronic
1172544655 20:35750278-35750300 TTGGATGAATGGATGGACAAAGG - Intergenic
1173353782 20:42268507-42268529 TGGGAGTTGCAGATGGACAGTGG - Intronic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174564447 20:51455323-51455345 TAGGAAGTGCAGATGCTCAAAGG - Intronic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176758847 21:10752596-10752618 TAGGATCTGCAGGTGGACATTGG + Intergenic
1177375699 21:20268494-20268516 ATGGATATGCATATGCACAAAGG + Intergenic
1178740208 21:35192951-35192973 GTGGAAGTTAAGATGGACAAAGG - Intronic
1179623633 21:42634600-42634622 GTGGGTGAGCAGATGGACAATGG - Intergenic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1181861094 22:25818743-25818765 TTGGTTTTGCAGGTGGAGAAGGG + Intronic
1183136717 22:35896072-35896094 TTGGATTTGAACATGGAGAAAGG - Intronic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184456695 22:44614924-44614946 TTGGGTTTGCAGATGGCCACTGG - Intergenic
1185193439 22:49453132-49453154 GTGGATGGGCAGATGGATGATGG + Intronic
1185193478 22:49453345-49453367 GTGGATGGGCAGATGGATGATGG + Intronic
951016791 3:17741138-17741160 TAACATGTGCAGCTGGACAAGGG - Intronic
951305131 3:21050901-21050923 TTGGATGTGGATAGGGAGAAGGG - Intergenic
951734611 3:25850508-25850530 TAGGATTTTCAGATGGCCAAGGG - Intergenic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
951863098 3:27275953-27275975 TTGCATGCGCACATGGGCAAAGG - Intronic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
953266369 3:41392968-41392990 TTGGATATGCATATGGATAGAGG - Intronic
955169573 3:56550194-56550216 TTGGCTTTGAAGATGGAGAAGGG - Intergenic
955594350 3:60572795-60572817 TTGGCTGGGGAGATGGAAAAAGG + Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960259313 3:115547455-115547477 TTGGAAGTGAAGAAGGATAAGGG + Intergenic
960765627 3:121126882-121126904 TTGGATTTGAAGATAGACAAAGG - Intronic
961137452 3:124525186-124525208 GTGGATGTGGACATGGATAATGG + Intronic
962252363 3:133843646-133843668 CTGGGTGTGCAGATGGACTCAGG + Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
963805488 3:149717393-149717415 TTGATTGTGCAGATTGATAAAGG + Intronic
963868107 3:150384853-150384875 TTGGAAGTGCAGAGAGAGAAGGG + Intergenic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
968702275 4:2062732-2062754 GTGGCTGTGCAGAGGGGCAATGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
970669508 4:18379992-18380014 TTGGAGGTGAAGATAAACAAAGG + Intergenic
971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG + Intergenic
973933392 4:55816883-55816905 TTGGATATGGAAATGGAGAAAGG - Intergenic
974016068 4:56650325-56650347 TGGGATGTGCTGATGGAGATGGG + Intronic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
977028473 4:91851836-91851858 CTGGCTGTGCTGAAGGACAAGGG - Intergenic
978926286 4:114249641-114249663 TTGGCTTTGACGATGGACAAAGG + Intergenic
980791725 4:137629599-137629621 TTGGATGTGTAGGTGCACAATGG + Intergenic
980917058 4:139043391-139043413 GTGGATGTGCAGAAGCAGAAAGG - Intronic
981649281 4:147037726-147037748 ATGGATGTGCAGATGAAACAGGG + Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982956205 4:161770239-161770261 TGGGAGGTGGAGATGGTCAATGG + Intronic
984352905 4:178618820-178618842 TTGGCTTTGAAGATGGAGAAAGG + Intergenic
984435051 4:179699157-179699179 TTGCATGTTCATATGGATAAGGG + Intergenic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
985649062 5:1098948-1098970 ATGAATGTGCAGAATGACAAGGG - Intronic
985661511 5:1159379-1159401 GTGGATGGGAAGAAGGACAAGGG + Intergenic
985709249 5:1419062-1419084 TAGGATGGACAGATGGATAATGG - Intronic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987086498 5:14474421-14474443 GTGGGTGTGCAGATGAAGAATGG - Intronic
988426598 5:31072511-31072533 TTGGATATGAAGATGGTTAAAGG - Intergenic
988981379 5:36572744-36572766 TTGGATGGGCAGGTGGAATAGGG - Intergenic
989314805 5:40066044-40066066 TTGTTTGTACAGATGTACAAAGG + Intergenic
989709044 5:44374153-44374175 TTGTCTTTGAAGATGGACAAAGG - Intronic
989943165 5:50179359-50179381 GTGCATGTGCACATGGACACAGG - Intergenic
990647482 5:57860700-57860722 CAGGATGTGCAGAGGCACAAAGG + Intergenic
991573322 5:68077885-68077907 TTGGATGGCCAGCTGGACAATGG + Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995730397 5:115234057-115234079 GTGGATGTGCAGATGTACCATGG - Intronic
997128929 5:131257206-131257228 TTGGAAGTGAAGTTGGACGATGG - Intronic
997201526 5:132012623-132012645 TTGGAGGTGCAGATGTTCATGGG - Intergenic
997745520 5:136296871-136296893 TGGGCTGTGAAGATGGCCAAAGG - Intronic
997775610 5:136601759-136601781 TTGGACCTGCAGGTGCACAAAGG + Intergenic
999448194 5:151658334-151658356 TTGGATGAGAAGATTGAAAATGG - Intergenic
999811456 5:155131339-155131361 ATGGATGGGGAGGTGGACAAGGG + Intergenic
1000651558 5:163824280-163824302 TTTGATGTGCAGATGGACCTAGG + Intergenic
1001736102 5:174003623-174003645 TTTAATGTGAAGATGGACAGAGG + Intronic
1001931302 5:175674983-175675005 TTGGCTTTGCAGGTGGAGAAAGG - Intronic
1002069088 5:176668212-176668234 TTGGCTGTGGAGAGGCACAAAGG + Intergenic
1003047185 6:2744632-2744654 CAGGATGTGCAGAGGGACAGTGG - Intronic
1006770537 6:36548968-36548990 TTGGATTTGCAGACAGAAAATGG - Intergenic
1008066976 6:47060567-47060589 TTGGATCAGCAGTTGGCCAAGGG + Intergenic
1010016081 6:71105904-71105926 TTGGATGAGCAAATGTAGAAAGG + Intergenic
1011941512 6:92848829-92848851 TTTAAGGTGCAGATGGCCAAGGG - Intergenic
1012858453 6:104530015-104530037 TTAGAATTGCAGATGCACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017770629 6:157641619-157641641 TTGGATTTGGAGATTGGCAAAGG - Intronic
1018018950 6:159739895-159739917 TTTTATGTGCAGAAAGACAAAGG - Intronic
1018667924 6:166156428-166156450 AGGGTTGTGGAGATGGACAAGGG + Intergenic
1019710107 7:2514272-2514294 GTGGATGTGCAGATACACAGAGG - Intronic
1020460406 7:8423903-8423925 TTGGATTTGGAGATGTACAAAGG + Intergenic
1021105695 7:16637211-16637233 TTGAATGTGCTGAGGGAGAAAGG + Intronic
1022217555 7:28279349-28279371 TTGGCAGTGCAGATGAAAAACGG + Intergenic
1023080726 7:36523811-36523833 TTGGATGTTCAGATTGGGAATGG - Intronic
1023422880 7:40002010-40002032 TTGGATTTCAAGAAGGACAAAGG + Exonic
1023727044 7:43153565-43153587 TTGGTTGTGCAGCTGATCAAGGG + Intronic
1033015790 7:137670198-137670220 TGGGCTGTGCAAATAGACAATGG + Intronic
1033261838 7:139850723-139850745 TTGGATGCTGAGATGGACAGAGG + Intronic
1034109678 7:148524495-148524517 TTGGATATGCACATTGAAAAAGG + Intergenic
1034841137 7:154398440-154398462 TTTGATGTGCAAATGAACAAAGG - Intronic
1034899058 7:154896260-154896282 CTGGATGTGCCCACGGACAAGGG + Intergenic
1035228023 7:157444259-157444281 TTGGCTCTGCAGATGGCCAGCGG - Intergenic
1036571554 8:9984264-9984286 TTATGTGTGCACATGGACAAGGG + Intergenic
1037156388 8:15704678-15704700 TTGGATGTACAGACAGACACAGG - Intronic
1038197264 8:25379814-25379836 TTGTTTGTGGAGATGGAAAAAGG - Intronic
1038693643 8:29785437-29785459 TTTCATGAGCAGATGCACAAAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039908554 8:41805878-41805900 TTGGATATGTAGTTGGAAAAAGG + Intronic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1042564867 8:70101293-70101315 GTGGATGTGCATATGGAAATGGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045017637 8:98012742-98012764 GTGGATGTGCAGCTGGACCAGGG + Intronic
1046628045 8:116596154-116596176 TTTGATGTGGAAATGAACAAAGG - Intergenic
1047407180 8:124595483-124595505 CTGGCTTTGAAGATGGACAAAGG - Intronic
1048580776 8:135728513-135728535 GTGGATGTGCAGGTGGAGATGGG - Intergenic
1049195154 8:141311682-141311704 TTCCATGGGCAGCTGGACAATGG - Intergenic
1050335022 9:4582504-4582526 TTGTAGGGGCAGATGGGCAAGGG - Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1053288373 9:36864464-36864486 GTGGATGTGCAGGTGGGAAAAGG + Intronic
1056668917 9:88606617-88606639 TTTAATGTGCACATGGAGAAAGG - Intergenic
1056928806 9:90857801-90857823 TGGGCTGGGCAGATGGACAGAGG - Intronic
1057041411 9:91850518-91850540 CTGGCTCTGAAGATGGACAAGGG + Intronic
1057706536 9:97398995-97399017 CTGGAGGGGGAGATGGACAAAGG - Intergenic
1057934223 9:99222722-99222744 TAGCATGTGAAGATTGACAAAGG + Intronic
1058095624 9:100857071-100857093 TTGGCTTTGAAGATAGACAAAGG - Intergenic
1059252212 9:112895746-112895768 GTGGATGGGTAGATGGATAATGG - Intergenic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1059564430 9:115369270-115369292 TTGGAAGTGGTGATGGAGAATGG - Intronic
1059752663 9:117262876-117262898 TTGGCTTTGCAGATGGAGGAAGG + Intronic
1060823278 9:126673509-126673531 AGGGAGGTGGAGATGGACAAGGG + Intronic
1062390627 9:136332306-136332328 TTGGAGGTGCAGAATGACAGAGG + Intronic
1203792387 EBV:158872-158894 TTGGAGGTGCAGGTAGAGAAGGG + Intergenic
1203379096 Un_KI270435v1:13047-13069 TTGAATCTGCAGTTGGACACTGG + Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1187333896 X:18365121-18365143 CTGGCTTTGAAGATGGACAAAGG - Intergenic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1187792159 X:22962810-22962832 AGGGATGTGCAGATGGAGACTGG - Intergenic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193258738 X:79380246-79380268 TTGGAGTTTCAGCTGGACAATGG + Intergenic
1194806837 X:98339578-98339600 TTTGATGTGTTGATGGACACAGG + Intergenic
1195322296 X:103729567-103729589 TTGGAGATGGAGATGGACAGAGG - Intergenic
1195352832 X:104010898-104010920 TTTGATGTGAAGATGGGCAGAGG - Intergenic
1198806299 X:140498712-140498734 TGGGATGTTCAGAAGGACACTGG + Intergenic
1199943927 X:152650722-152650744 TTGGCTGTGCACCTGTACAAAGG - Intronic
1200972308 Y:9165996-9166018 TGGGATATGCAGATGGATTAGGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201293240 Y:12442126-12442148 TTGGATGTGTAGGTGAAGAATGG - Intergenic