ID: 951862257

View in Genome Browser
Species Human (GRCh38)
Location 3:27266255-27266277
Sequence AGTCTTTGCAGTATTGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951862257 Original CRISPR AGTCTTTGCAGTATTGGGCT AGG (reversed) Intronic
900579691 1:3402948-3402970 AGTCCTTGCACTCGTGGGCTTGG - Exonic
900640859 1:3687484-3687506 AGTCTCTGCAGTGCTGGGCCTGG + Intronic
900822348 1:4899254-4899276 AGTCATTGCATTAGTTGGCTTGG + Intergenic
901038193 1:6348996-6349018 AGCCTCTGCACTATGGGGCTCGG - Intronic
901261791 1:7876515-7876537 AGCATTGGCAGTAGTGGGCTAGG - Intergenic
901517691 1:9760372-9760394 AGGCTCTGCAGTGATGGGCTCGG - Intronic
906494910 1:46298343-46298365 ATGCTTTGAAGTATTGGGCCTGG + Exonic
907464569 1:54626374-54626396 AGACTTATCAGTATGGGGCTTGG - Intronic
909842154 1:80341266-80341288 AGTCTTTCCGGTATTTGGCAGGG - Intergenic
916761362 1:167820442-167820464 AGTCTGAGCAGCATTGGCCTAGG + Intronic
917426116 1:174915980-174916002 AGTCTTTGCAGTCTTGGATTAGG - Intronic
918693272 1:187509664-187509686 AATATTTACAGTGTTGGGCTTGG - Intergenic
920796701 1:209144393-209144415 AGTGTTTTCAGCATTGTGCTAGG - Intergenic
923674526 1:236068357-236068379 TGTGTATGCAGCATTGGGCTAGG - Intergenic
924128717 1:240883166-240883188 AGTCTTTGCTGTTGTGGGGTGGG + Intronic
924490684 1:244534998-244535020 AGTCATAGCATTACTGGGCTTGG - Intronic
1064651346 10:17513012-17513034 AATCTTTAAAGTATTGGGTTTGG - Intergenic
1065081786 10:22136422-22136444 GTTCTTTGCAGTATTTGGGTTGG + Intergenic
1066348116 10:34609415-34609437 AGTCTTGACAGTATTGAGATTGG - Intronic
1066541918 10:36456970-36456992 AGTATTTGCAGGAATGGGCTAGG + Intergenic
1067039291 10:42940487-42940509 AGTCCTTGGGGTCTTGGGCTGGG + Intergenic
1068395601 10:56457186-56457208 AGTAGTGGCAGTGTTGGGCTGGG - Intergenic
1068427436 10:56885383-56885405 ATTCATTGCAGTATTGGGGTTGG - Intergenic
1070557108 10:77537162-77537184 AGTCTTGGGAGTGTTGGGTTAGG - Intronic
1072024878 10:91445466-91445488 AGTCTTAGAAGTATGGGACTGGG + Intronic
1073645196 10:105294212-105294234 AGTAGTGGCAGTGTTGGGCTGGG - Intergenic
1073890223 10:108091973-108091995 AGTCACCGCAGTCTTGGGCTTGG + Intergenic
1075615572 10:123888887-123888909 CGTGTTTTCAGTATGGGGCTTGG + Intronic
1076312200 10:129516579-129516601 ATTCTTTACAGTATTGGGAAAGG - Intronic
1077422031 11:2456374-2456396 AGTCTTCTCAATATTGGCCTTGG + Intronic
1078342521 11:10509025-10509047 AGTCCTTGCTGTATTATGCTTGG + Exonic
1085455899 11:76665263-76665285 AGTCTTCTCAGTATTGAGATAGG + Intronic
1085655757 11:78313270-78313292 AGTCTTTGCTTTATTGTGGTAGG - Intronic
1085806298 11:79639819-79639841 ACTCTTTTCAGTATTGGCTTAGG + Intergenic
1086387318 11:86322681-86322703 AGTCTTTGCAACCTTGGGTTAGG - Intronic
1086898879 11:92343955-92343977 AGACTTTGCAGTATAGGTGTGGG + Intergenic
1088175368 11:107047605-107047627 AATCTGTGCAGTATTGATCTAGG + Intergenic
1090651266 11:128808411-128808433 AGTCTTTGCAATACTGGTTTAGG - Intronic
1091481969 12:842451-842473 ACTCTTTCCATTATGGGGCTAGG + Intronic
1093495350 12:19750768-19750790 ATTCTTTGCAGGATTTGGTTGGG + Intergenic
1095772034 12:45970440-45970462 TGTCATGGCAGGATTGGGCTTGG - Intronic
1096966918 12:55635912-55635934 AGACTTTACTGTATTGGTCTTGG - Intergenic
1101434686 12:104654644-104654666 AGTCTCTGGAGCACTGGGCTGGG - Intronic
1102360024 12:112277643-112277665 ACTCCTTGCTGTAGTGGGCTTGG - Intronic
1103703606 12:122860122-122860144 AGTCATTGCTGTCTTGGTCTCGG + Intronic
1108961407 13:56236519-56236541 ATTCATTGCAGCATTGTGCTGGG + Intergenic
1112254825 13:97820305-97820327 AGTCTTTGAAAAATTAGGCTGGG + Intergenic
1119477789 14:74941171-74941193 AGTCCTTGCGGCACTGGGCTGGG + Intergenic
1120224611 14:81776634-81776656 AGTCTCAGAAGTACTGGGCTAGG + Intergenic
1126236989 15:46397472-46397494 ATGCTTTGCAACATTGGGCTGGG + Intergenic
1126497468 15:49307946-49307968 AGTCTTTGCAGCATGGGAATGGG + Intronic
1126842429 15:52730250-52730272 AGTCTTTGCAGATTTGGGGAGGG - Intergenic
1127378015 15:58402740-58402762 AGTCATGGCAGTAATGGGCACGG - Intronic
1130965920 15:88697560-88697582 TGGCTTTGCAGCTTTGGGCTTGG - Intergenic
1130985272 15:88840730-88840752 TGTCTTTGCAGTCTCGGGGTAGG + Intronic
1137308050 16:47224523-47224545 AGACTTTACAGTATTAGTCTGGG + Intronic
1138709535 16:58954138-58954160 AGCCTTTGCAATAATTGGCTGGG - Intergenic
1139123095 16:64043751-64043773 AGTCACAGCATTATTGGGCTTGG + Intergenic
1145176787 17:20707529-20707551 AGTCATTGCAGTGGTGGGGTCGG - Intergenic
1153844412 18:9036066-9036088 AATCTTTGCAATCTTGGGGTAGG + Intergenic
1154414732 18:14170867-14170889 AGCCTGGGCAGTGTTGGGCTGGG + Intergenic
1155497106 18:26453515-26453537 ATTCTGTGCAGTATTTGGTTGGG + Intergenic
1159387214 18:67742017-67742039 AGTCTGTCCAGTTTTGTGCTTGG - Intergenic
1159540527 18:69768619-69768641 AGTCTCTGCCGTATTCTGCTTGG - Intronic
1162045292 19:7995721-7995743 AATCTTTGTGGCATTGGGCTGGG + Intronic
1162831343 19:13286579-13286601 AGTCTTAGCTGAATTGGTCTGGG + Exonic
1164005926 19:21149675-21149697 AGTCTTTGCCTTTTTGAGCTTGG + Intronic
1167339078 19:48904159-48904181 ACTCTGGGCAGTATTGGGCTGGG + Intronic
925327996 2:3037594-3037616 AGTCTTTGCAGGGTCGGCCTGGG + Intergenic
925698815 2:6612775-6612797 AGTCATAGCATTACTGGGCTTGG - Intergenic
928935844 2:36677215-36677237 AGTCTCTGCAGAATTGAGGTTGG - Intergenic
929084624 2:38156251-38156273 AGTCTTTGGTGTTTTGGGCTTGG - Intergenic
930439744 2:51390970-51390992 AGTCCTAGTAGTATTGGACTGGG - Intergenic
934020944 2:87951318-87951340 AGTTTTTGCAGTTTTGGAGTTGG - Intergenic
935989579 2:108706680-108706702 AGTCACAGCATTATTGGGCTTGG + Intergenic
937572276 2:123379069-123379091 AGCATTTGCATTATTGGGGTAGG - Intergenic
943886888 2:193229317-193229339 AGAGTTTGCAGTATTTGACTAGG - Intergenic
946850408 2:223900840-223900862 AGGGTTTGCATTAATGGGCTTGG + Intronic
946947588 2:224837586-224837608 TCTCTTTGCATTAATGGGCTAGG - Intronic
947580618 2:231314727-231314749 AATCTTTGCAATGTTGGCCTAGG - Intronic
948388380 2:237595632-237595654 AGTCTTTACAGAATTAGGCAGGG - Exonic
1169686288 20:8276780-8276802 ATCCTTTACAGTACTGGGCTTGG - Intronic
1171464579 20:25318584-25318606 AGTCTCTGCAGGATTGGGAGGGG + Intronic
1174390506 20:50216001-50216023 TGTGTTTGCAGTGTGGGGCTGGG + Intergenic
1176858288 21:13987387-13987409 AGCCTGGGCAGTGTTGGGCTGGG - Intergenic
1179510407 21:41869248-41869270 AGTCTTTGGAACCTTGGGCTTGG - Intronic
1180559479 22:16602997-16603019 AGTCTTAGCTGTAAGGGGCTTGG + Intergenic
1181591451 22:23887890-23887912 AATCTTTGCAACATTGGGATAGG - Intronic
950683055 3:14598452-14598474 AGGCTTTGAAGTCTTGGGTTGGG - Intergenic
951862257 3:27266255-27266277 AGTCTTTGCAGTATTGGGCTAGG - Intronic
953281899 3:41566881-41566903 AGTCTTTGCAGTCTGGAACTAGG + Intronic
953904324 3:46860916-46860938 AGGGGTTGCAGGATTGGGCTGGG - Intronic
955201083 3:56852778-56852800 AATCTTTTCAGTTTCGGGCTGGG + Intronic
958625522 3:96618072-96618094 AGTCCTTGCTGTATTATGCTTGG + Exonic
959048033 3:101496557-101496579 AGTGTTTGAAGTGTTTGGCTGGG - Intronic
964171836 3:153779792-153779814 AGTCCCAGCAGTGTTGGGCTAGG - Intergenic
965415992 3:168393188-168393210 AATCTTTGTGATATTGGGCTAGG + Intergenic
965686918 3:171313928-171313950 AGTCGTTGCCGGAATGGGCTAGG + Intronic
967217473 3:187222734-187222756 AGTCCTTGCAGTAATGAACTTGG - Intronic
969393313 4:6905252-6905274 AATCTTTAAAGAATTGGGCTGGG - Intergenic
970152659 4:13106352-13106374 AGTTATTGCAGAAGTGGGCTTGG - Intergenic
970265042 4:14273220-14273242 AGTCTCTGTAGTATTGTACTGGG - Intergenic
972020570 4:34308489-34308511 AGCCTCTGCATTATTGAGCTGGG - Intergenic
972279726 4:37590420-37590442 AGTATTTGCAGTACTGGCCCAGG - Exonic
973054040 4:45631407-45631429 AGTCACAGCATTATTGGGCTTGG + Intergenic
976792729 4:88897265-88897287 AGTCTATGCAGTATTGGTCATGG + Intronic
977011524 4:91640435-91640457 AATCTTAGCAGTATTGATCTGGG + Intergenic
979564949 4:122144893-122144915 AGTCATAGCATTAATGGGCTTGG - Intergenic
980154709 4:129090519-129090541 AATCTTTGCAGCCTTGGGTTAGG + Intronic
983002530 4:162435188-162435210 ACTCTTCTCAGTATTGGCCTTGG - Intergenic
986799319 5:11243282-11243304 TGTCTCTGCAGCCTTGGGCTTGG + Intronic
988200619 5:28064574-28064596 AATCTTTGTAATCTTGGGCTTGG - Intergenic
988780607 5:34518070-34518092 AATATTTGCAGTCTTGGGCTAGG + Intergenic
992188894 5:74270841-74270863 TGTCTTTGCAGCCTTGGGTTAGG + Intergenic
994573527 5:101545033-101545055 ACTCTTTCCAGTTTTGAGCTTGG - Intergenic
995237021 5:109840764-109840786 AGTGTTCCCAGTATTTGGCTGGG - Intronic
998871825 5:146560369-146560391 AGTGTTTTCAGTATTGGTTTGGG - Intergenic
1001206258 5:169766006-169766028 TATCATTGCAGCATTGGGCTAGG + Intronic
1001591267 5:172867082-172867104 AGTCTTTGCAGACCTTGGCTTGG + Intronic
1002206155 5:177563941-177563963 AGTTGTGGCAGTACTGGGCTGGG + Intergenic
1002877517 6:1224743-1224765 AGTCTCTGCATTCTTGGGCCAGG - Intergenic
1002991144 6:2239992-2240014 AGGTTTGGCATTATTGGGCTGGG - Intronic
1003427200 6:6005615-6005637 AATCCTTGCAGTATTGGGGGAGG - Intronic
1003603956 6:7542577-7542599 AGTCGTTGCAGTCGTGGTCTCGG - Intronic
1003799468 6:9647161-9647183 AGTCTGTGCTGTATGGGGGTAGG + Intronic
1006821879 6:36902849-36902871 AGTCCTTGGCCTATTGGGCTAGG + Intronic
1010305762 6:74320061-74320083 TGTCTTTTCAGTCTTAGGCTGGG + Intergenic
1011173264 6:84530309-84530331 AGTGTCTGCAATATAGGGCTGGG - Intergenic
1013722764 6:113050698-113050720 AGTCTTTGTAGGATTGGGTTAGG - Intergenic
1015858112 6:137647351-137647373 GGTCTTTGCAGTCCTGGACTTGG + Intergenic
1016808305 6:148235160-148235182 GTTCTTTGCAGAATTGGGTTTGG - Intergenic
1022340957 7:29467995-29468017 TGTCTTTGCAGCATGGGTCTTGG + Intronic
1022448309 7:30488965-30488987 AATCTTTGCAATCTAGGGCTTGG - Intergenic
1023792177 7:43761702-43761724 AGTCTGTTCAGTTTGGGGCTAGG + Intronic
1024450635 7:49538614-49538636 AATCTTTACAACATTGGGCTTGG + Intergenic
1024580821 7:50799406-50799428 AATCACTGCAGTATTGGTCTAGG - Intergenic
1026370522 7:69693964-69693986 GGTCTTTACACTATTGGGCAGGG + Intronic
1026788237 7:73315167-73315189 AGTCTTTGCCTTTTTGAGCTTGG - Intronic
1027346678 7:77267286-77267308 ATCCTTTGCAATATTGGGCCAGG - Intronic
1027435727 7:78162566-78162588 TGTCTTTGCAGTAAAAGGCTGGG + Intronic
1027978265 7:85185916-85185938 TCTCTTTGTAGTAGTGGGCTTGG - Intronic
1031412043 7:121450886-121450908 TGGCTTAGCAGTATTGGCCTTGG - Intergenic
1034126542 7:148676472-148676494 AGCCTCAGCATTATTGGGCTTGG + Intergenic
1034617756 7:152434820-152434842 AGTCTTAGCTGTAAGGGGCTTGG - Intronic
1036114207 8:5940813-5940835 AGTTTTTGGAGGATGGGGCTGGG - Intergenic
1038608548 8:29036197-29036219 AGTCTTTGCAGTGAAGGGCCTGG + Intronic
1038981192 8:32761388-32761410 AGTCTTTCCACTCTTGGACTGGG + Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042495219 8:69448014-69448036 AGACTTTGTAGCACTGGGCTTGG - Intergenic
1043172269 8:76980143-76980165 AGACTTGTCAGTATTGGGGTAGG - Intergenic
1046676983 8:117120523-117120545 AAACTTTACAGTATTGGTCTTGG + Intronic
1048117598 8:131542796-131542818 ATTCTTAGCAGTCTTGGGGTTGG - Intergenic
1048964790 8:139607745-139607767 AGTCTTTCCAGCAGTGGGCTGGG - Intronic
1049599176 8:143499106-143499128 AGTGTTTGCAACCTTGGGCTTGG - Intronic
1054965555 9:71022917-71022939 AATCTTTGAGGTCTTGGGCTAGG + Intronic
1055639444 9:78308161-78308183 GGACTTTGCAGTGATGGGCTTGG + Intronic
1057501818 9:95602372-95602394 ATTTTTTGCAGGATTGGGCAGGG + Intergenic
1058124018 9:101171045-101171067 AGTCATTGCTGTCTTGGGGTTGG - Intronic
1060067317 9:120513957-120513979 TGTCTTTGCATTATGGTGCTAGG - Intronic
1061401628 9:130371588-130371610 AGTCCTTGCAGGATTTGGATGGG - Intronic
1190327611 X:49216318-49216340 GGTCTCTGCAGGATTGGGTTGGG - Intronic
1193077456 X:77370192-77370214 AGCCTTGGGAGTGTTGGGCTTGG - Intergenic
1197055043 X:122108353-122108375 ATGCTTTGCAGTATTGCCCTAGG - Intergenic
1199123581 X:144087809-144087831 AGTTTTTGCAGTTTTGGAGTTGG + Intergenic
1201668445 Y:16487553-16487575 AAACTTTGGAGTATTGGGCATGG + Intergenic