ID: 951864231

View in Genome Browser
Species Human (GRCh38)
Location 3:27289361-27289383
Sequence TGCCACTACCTCCTCCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951864226_951864231 8 Left 951864226 3:27289330-27289352 CCATTCTAGCCCCATTTGTTTTG 0: 1
1: 0
2: 0
3: 12
4: 243
Right 951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 179
951864229_951864231 -3 Left 951864229 3:27289341-27289363 CCATTTGTTTTGCTTCTGCCTGC 0: 1
1: 0
2: 3
3: 35
4: 544
Right 951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 179
951864227_951864231 -1 Left 951864227 3:27289339-27289361 CCCCATTTGTTTTGCTTCTGCCT 0: 1
1: 0
2: 3
3: 41
4: 484
Right 951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 179
951864228_951864231 -2 Left 951864228 3:27289340-27289362 CCCATTTGTTTTGCTTCTGCCTG 0: 1
1: 0
2: 1
3: 32
4: 403
Right 951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951864231 Original CRISPR TGCCACTACCTCCTCCTTTA AGG Intronic
902694804 1:18133133-18133155 TCCCCCTCCCTCTTCCTTTATGG - Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903279275 1:22241246-22241268 TGTCACTACCTCCTTTTTCATGG + Intergenic
904757586 1:32776889-32776911 CGCCACAACCTCCTCCTCTCAGG - Intronic
904811470 1:33165776-33165798 TGCAACAACCTCCTCCTCTTTGG + Intronic
905459434 1:38113003-38113025 TTCCTCTACCACCTCCTTCATGG - Intergenic
906403353 1:45521748-45521770 TGCCTCTTCCTCCTCCTGTCCGG - Exonic
906480655 1:46197275-46197297 TGACACTTCCCCCTCCATTAGGG + Intronic
906718753 1:47990314-47990336 TGCCACTACTTCTCCCTCTAGGG - Intronic
908679961 1:66649520-66649542 TGTCTCTATCTCCTCCTTTAGGG - Intronic
908762571 1:67525612-67525634 AGCTACAACTTCCTCCTTTAAGG + Intergenic
909281543 1:73761229-73761251 TCCCACAACCTTCTCTTTTATGG + Intergenic
911464954 1:98239842-98239864 AGCCACTCCCACCTCCTTAAAGG - Intergenic
911770363 1:101733186-101733208 TTACACCACCTCCTCCTTGAAGG + Intergenic
913026297 1:114844797-114844819 TGCCATTCCCTTTTCCTTTAGGG + Intergenic
915642511 1:157239970-157239992 TGCCTCTGCCTCCTCTTTTTAGG + Intergenic
916007096 1:160672684-160672706 TCCTACTTCCTCCTCCTTGAAGG + Intergenic
917707064 1:177645522-177645544 TGCCACTCATTCCTTCTTTAAGG + Intergenic
919597160 1:199578545-199578567 TGCCACTACCTCCTTCTGTGTGG - Intergenic
919764415 1:201116959-201116981 TGCCACCACCTCCTCCTGTCAGG - Intronic
921542008 1:216427968-216427990 TGCCTCTCTCTCCTTCTTTATGG - Intergenic
924695863 1:246398941-246398963 TACAACTATCTACTCCTTTATGG - Intronic
1064728724 10:18307384-18307406 CGCCACAACCTCCACCTTTCAGG - Intronic
1064738282 10:18406294-18406316 AGCCACTACCTCCTCCAAGAAGG - Intronic
1065216555 10:23454799-23454821 TGCCACAGCCTCTTCCTTTTAGG + Intergenic
1065323821 10:24533165-24533187 TGTCACCACCTCCTCCTCAAAGG + Exonic
1068262410 10:54599924-54599946 TGCCACCAACTCCTCCTTAGTGG - Intronic
1070390479 10:75966348-75966370 TGAAAATACCTCCTACTTTATGG + Intronic
1070713162 10:78698179-78698201 TGCCTATGCCTCCTCCTTTTGGG - Intergenic
1071489021 10:86123391-86123413 TGCCCCTACCTCCACCATAAAGG - Intronic
1072563211 10:96596117-96596139 TGCCCCAACCACCTCCTCTATGG + Intronic
1074043942 10:109819754-109819776 TTCCACTTTCTCCTCCTTCAGGG + Intergenic
1076441098 10:130481884-130481906 CTCCACTGCCTCCTCCTTTAAGG + Intergenic
1077306132 11:1869432-1869454 TCCCCCTCCCTCCTCCTTCAAGG - Intronic
1077536774 11:3128341-3128363 TGCCCCTACCTCCTACTCTCAGG + Intronic
1078340144 11:10492820-10492842 TCCCACAACCTCCTCCATTTGGG - Intronic
1079470821 11:20775872-20775894 TGTCCCTAACTCCTCCATTAGGG - Intronic
1080356416 11:31452163-31452185 TGACACCACATCCTCCTATAGGG - Intronic
1081929503 11:46858937-46858959 TGCCTGTTCCTTCTCCTTTATGG - Exonic
1087773481 11:102236652-102236674 AGACACTTCCTCCTCCTTCAGGG + Intergenic
1088361230 11:108992139-108992161 TGCCACTACCTCCTCTTAAGAGG - Intergenic
1088669447 11:112127283-112127305 TGCCTCTCCCACCTCATTTATGG + Intronic
1088812456 11:113400818-113400840 GGCCTCCTCCTCCTCCTTTATGG + Intergenic
1089125924 11:116176549-116176571 AGCCACTGCCTCTTCCTCTAAGG + Intergenic
1089632893 11:119794498-119794520 TTCCACTCCCTCCTTCTTTCCGG - Intergenic
1090182883 11:124716501-124716523 TGCTACTGGCTCCTCCCTTATGG - Intergenic
1092768839 12:11878244-11878266 TGAAACTTCCTCCTCTTTTAGGG - Intronic
1093564623 12:20588118-20588140 TGCCCCTACCGCCTTCTTCATGG - Intronic
1093958547 12:25250017-25250039 TACCTCCACCTCCTCCTTTGTGG + Intronic
1093960130 12:25263558-25263580 TGCCACTACCCTTTCCCTTAAGG + Intergenic
1094837495 12:34329008-34329030 TGCCTCTACCTCCACTTTCAAGG + Intergenic
1094851014 12:34382395-34382417 TGCCTCGACCTCCTCTTTCAAGG + Intergenic
1096085607 12:48863240-48863262 GGCCACTTCCTCCTTCCTTATGG + Intronic
1096148180 12:49293457-49293479 TGCCAGTTCCTTCTCCTTGATGG - Intronic
1097030809 12:56087958-56087980 TACCCCTACCTCCTCCTCAAAGG - Intronic
1097041723 12:56159949-56159971 TGACACTTCCACCTCCTTTATGG + Intronic
1097755594 12:63403633-63403655 TGCCCCTAACTTCTCTTTTAAGG - Intergenic
1098164054 12:67674706-67674728 TGCCTCTTCCTCCTCTTATAAGG - Intergenic
1100037831 12:90275195-90275217 TGCCACTCTCCCCTCCTTTCAGG + Intergenic
1100954919 12:99896419-99896441 TGGCAGTAACTCCTTCTTTAAGG + Intronic
1101386325 12:104261237-104261259 TGCCACAACCTCCACCTCTAGGG + Intronic
1108478414 13:50843371-50843393 TCGCACTACCTCCTCCTCTGGGG + Exonic
1112836480 13:103520952-103520974 TGCCTATACCTGCTCCCTTAGGG + Intergenic
1116220715 14:42084118-42084140 TGCCACTATCTCCTCCTGTAAGG + Intergenic
1118125942 14:62904479-62904501 TGCCCCTACCTCTTCCCCTATGG + Intronic
1120922589 14:89768537-89768559 TACCACAACCTCCTCCTCTCAGG + Intergenic
1122988426 14:105224489-105224511 TGCCTCTGCTTCTTCCTTTAAGG + Intronic
1124835618 15:33193984-33194006 TGCCACTACCACCACCTCCAAGG - Exonic
1124838048 15:33214734-33214756 AGCCACTACCTCATCCCTCAAGG - Intergenic
1128114862 15:65098929-65098951 TGCCACTAGCACCTCTTTTTGGG + Intronic
1129666264 15:77581172-77581194 TGCCATTACCTCCTCCAGCAGGG + Intergenic
1131067855 15:89445316-89445338 TGCCTCTACTTGCCCCTTTATGG - Intergenic
1131157449 15:90083937-90083959 TCCCACTACCTCCTCCCCTCAGG + Exonic
1132952233 16:2569839-2569861 TGCCACGCCCTCCTCCTAGAGGG + Intronic
1132962118 16:2630331-2630353 TGCCACGCCCTCCTCCTAGAGGG - Intergenic
1133305600 16:4806265-4806287 TTCCTCTCCCTCATCCTTTAAGG - Intronic
1134825138 16:17278424-17278446 GGTCACTACCTCTTCCTTTAAGG + Intronic
1139806049 16:69566164-69566186 TGCCGCTGCCTCCTCCTCGAGGG - Exonic
1141014596 16:80437258-80437280 TTCCACTACCACATCCTTTGGGG + Intergenic
1141951558 16:87343135-87343157 TGCCACTGCCTCCTGCTCTTGGG - Intronic
1142758593 17:2030032-2030054 CGCCCCTATCTCCTCCTTTATGG + Intergenic
1144811055 17:17999191-17999213 TGCCACTTGCTCCTCCGTTCAGG + Intronic
1146624624 17:34425824-34425846 TACCCCTTCCTCCTACTTTAAGG + Intergenic
1147189735 17:38731372-38731394 TGCCACCAGCTCCACCTTGATGG - Exonic
1147819544 17:43233559-43233581 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147820639 17:43239693-43239715 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147820848 17:43240952-43240974 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147821659 17:43245446-43245468 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147822751 17:43251601-43251623 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147825269 17:43266405-43266427 GGCCATGACCTCCTCCTTTGGGG - Intergenic
1147826111 17:43271141-43271163 GGCCATGACCTCCTCCTTTGGGG - Intergenic
1147826392 17:43272873-43272895 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147827281 17:43277750-43277772 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147828389 17:43283911-43283933 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147829499 17:43290063-43290085 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147830589 17:43296197-43296219 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1147831275 17:43299813-43299835 GGCCACGACCTCCTCCTTTGGGG - Intergenic
1150288357 17:63966671-63966693 TGCCTCTTCCCCGTCCTTTAAGG + Intronic
1152221761 17:79072634-79072656 TTCCTCTGCCTCCTCCTTCATGG - Intergenic
1159952442 18:74495476-74495498 TACCACTACCACATTCTTTAAGG - Intergenic
1160735872 19:662301-662323 TGCTACTTCCTGCTCGTTTAGGG - Intronic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1162145096 19:8608651-8608673 TGCCCCATCCTCCTCCTTCAGGG + Intronic
1162572974 19:11483205-11483227 TTCCACTTCCTCCTGTTTTATGG - Intronic
1163387495 19:17008755-17008777 TGGGCCTACCTCCTCATTTAGGG + Intronic
1165282142 19:34806727-34806749 TGCCCCTACATGCTGCTTTATGG - Intergenic
1167199988 19:48058221-48058243 TGCCACAACCTCCACCTTCCAGG - Intronic
925152433 2:1624429-1624451 TGTCACAACCTCCTCCTTGTGGG + Intergenic
926684670 2:15689763-15689785 TCCCACTTCCTCCTCCTGTGTGG + Intergenic
927618361 2:24623792-24623814 TGTCTCTTCCTCCTCCTATAAGG + Intronic
931458798 2:62432913-62432935 TTCCACTGCCTCCTCCTTTTGGG - Intergenic
935199982 2:100848088-100848110 GGCCTCTGCTTCCTCCTTTAAGG - Intronic
937356375 2:121200513-121200535 TGCCTCTCCCTCCTCCTTCAAGG - Intergenic
939006968 2:136800285-136800307 TGTGATTACCTCCTCCTTTAGGG + Intronic
939347283 2:140982083-140982105 TACCACTACACCCTCCTTAAAGG - Intronic
939894653 2:147776840-147776862 GGCCCCCACCTCCTCCTTCAGGG + Intergenic
941893922 2:170610620-170610642 TCCCACTACATCCTGCTTGATGG + Intronic
941990357 2:171549896-171549918 TTCCACTACCTTCTCTTTTGAGG + Intronic
942783972 2:179678434-179678456 AGGCACTTCCTCTTCCTTTAAGG - Intronic
942973780 2:181989810-181989832 TGCATCTTCCTCCCCCTTTATGG + Intronic
943872063 2:193012134-193012156 TGCCCCTAACTCCTCCCTGAAGG + Intergenic
945128131 2:206536175-206536197 TGCCAGGATCTCCTTCTTTAAGG + Intronic
945196753 2:207244021-207244043 TGCTACTACCTTCTACTGTAAGG + Intergenic
947296151 2:228632674-228632696 TGGCTCTACTTCCTCCTTTTGGG + Intergenic
1173550978 20:43932967-43932989 TGCCTCTACTTCCTTCTTGAAGG - Intronic
1177120649 21:17133099-17133121 TTGCACTCCCTCCTCCCTTAGGG - Intergenic
1178036769 21:28592955-28592977 TGCCACTATGTCCACCTTTGTGG - Intergenic
1178258160 21:31074381-31074403 TGCCACTACCCCCACCTTCCAGG + Intergenic
1179616356 21:42585965-42585987 AGCCACTAGCTCCTCCTTTTGGG - Intergenic
1180859378 22:19068601-19068623 TGCCCCTACCCCTTCCTTGAGGG + Intronic
1181519737 22:23438355-23438377 TGCCACCACCTCCTCCTGCCAGG + Intergenic
1183812074 22:40265961-40265983 TGTCACTACTTCCTGCTTTGTGG - Exonic
950267821 3:11588342-11588364 TGGCACTTCCTCCTGCTTCAAGG - Intronic
950667343 3:14505576-14505598 TGTGACTCCCTCCTCCTTCACGG + Intronic
951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG + Intronic
956054851 3:65287990-65288012 TGCCTCTACCTACTCCTGCAAGG - Intergenic
956592339 3:70927766-70927788 TGTCACTGATTCCTCCTTTAGGG + Intergenic
960878217 3:122317802-122317824 TGCATCTACCTCCTCCATAAGGG - Intergenic
965995453 3:174876763-174876785 TGCCACAAATTCCTCCTCTATGG - Intronic
969206384 4:5650176-5650198 TGCCACTAACTCTTCCTTCCTGG + Intronic
969536230 4:7757511-7757533 AGCCACTGCCTCCTTCTTTGGGG - Intergenic
969970161 4:11038560-11038582 TGCCACCACTTCCTCCTACATGG + Intergenic
972302243 4:37795722-37795744 TGCCTCAGCCTCCTCCTTTTAGG - Intergenic
972583967 4:40419728-40419750 TCACACTTTCTCCTCCTTTAAGG + Intergenic
973228236 4:47811103-47811125 TGCAAATACCTCCTCCTATCTGG + Intronic
977683287 4:99818425-99818447 TTCCTCTATCTCCTCCTTTGGGG - Intronic
978020448 4:103803891-103803913 TGCCACAATCTCCTCCTGTGAGG - Intergenic
979945691 4:126829261-126829283 TTGCTCTACCTCCTCCTGTATGG - Intergenic
981044348 4:140252346-140252368 TGCCTCTCCCTCCTCCTGCAAGG + Intergenic
986234688 5:5895863-5895885 TGCCATCACCTCCTGCTGTACGG - Intergenic
986312133 5:6558499-6558521 TTCCCCTTCCTCCTCCTTTAGGG - Intergenic
987818422 5:22932506-22932528 TCCCTCTACCTCCTCATCTATGG + Intergenic
989722157 5:44541852-44541874 TTCCACTACCTCCTAATTTGGGG - Intergenic
990721471 5:58700890-58700912 TGTCATTAATTCCTCCTTTATGG + Intronic
991592905 5:68273084-68273106 TGCCACTCCCCCCACCTTTGGGG + Intronic
991963618 5:72069741-72069763 TATCAGTACTTCCTCCTTTATGG - Intergenic
993281305 5:85928256-85928278 TACCACTTTCTGCTCCTTTAAGG - Intergenic
995042827 5:107608617-107608639 TGCCTCCATCTCCTGCTTTAAGG - Intronic
996810893 5:127515434-127515456 TGCCACCTCCACCTCCATTAGGG + Intergenic
998262238 5:140640102-140640124 TGCCACCACCACCTCCTCTCTGG + Intronic
999330403 5:150670179-150670201 TCTCACTACCTCCACCATTATGG + Intronic
999854533 5:155579826-155579848 TGCCCCATCCTCCTCCTTGAGGG - Intergenic
1001274293 5:170339126-170339148 TGCCACTTCCTCTTTCTTGATGG - Intergenic
1001812008 5:174636002-174636024 GTCCACTCCCTCCTCCTTTGAGG + Intergenic
1002589799 5:180282684-180282706 ACCCACTACCACCTGCTTTACGG + Intronic
1004558453 6:16723450-16723472 TGTCTCTTCCTCCTCCTTTTAGG - Intronic
1004587090 6:17013033-17013055 TCCCACTCCCACCTCCTCTAAGG - Intergenic
1006153551 6:32001984-32002006 TGCCACTGCCTCCCTATTTATGG - Intronic
1006159859 6:32034721-32034743 TGCCACTGCCTCCCTATTTATGG - Intronic
1006557212 6:34877865-34877887 TGCCATTACCGCATCCTTCATGG + Exonic
1009628499 6:66166031-66166053 AGCCAATACCTCCTCCTCTAAGG + Intergenic
1014461230 6:121698261-121698283 TGCCACTCACTCCTCCATTTCGG - Intergenic
1016488466 6:144569796-144569818 TGCCACCTCCTCCACCTTTAAGG - Intronic
1018464397 6:164029844-164029866 AGCCCCTACCTCCTCCTGTGAGG - Intergenic
1019591525 7:1837917-1837939 TGCCACCACCTCCTCCTGCCAGG - Intronic
1020766489 7:12328391-12328413 TCCCACTATCTCCTCCTCTCAGG - Intergenic
1027140172 7:75651102-75651124 TGCCCCTCCCTCCTCCTGTGTGG - Intronic
1028791817 7:94862036-94862058 TGTCTCTTCCTCTTCCTTTAAGG + Intergenic
1033230097 7:139590377-139590399 TGCCAGTGCTTTCTCCTTTAGGG - Intronic
1034071821 7:148193625-148193647 GGCCTCTAACTCCTCCTCTATGG + Intronic
1035407108 7:158606334-158606356 TGCTGCCTCCTCCTCCTTTAAGG + Intergenic
1036589038 8:10151079-10151101 TCCCCTAACCTCCTCCTTTACGG - Intronic
1036814262 8:11889340-11889362 TGTCTCTCCCTCCTCCTATAAGG - Intergenic
1037279451 8:17220677-17220699 TGCCACTTCCACCTTCTTAAAGG - Exonic
1040122822 8:43701354-43701376 TGCCACCTACTGCTCCTTTAGGG - Intergenic
1041838647 8:62245220-62245242 TACAACTCACTCCTCCTTTAAGG + Intergenic
1042094251 8:65194915-65194937 TCCCTCTGCCTCCTCTTTTAAGG - Intergenic
1042932395 8:74026569-74026591 TGCCCCTACCTTATCCCTTAGGG - Intronic
1044380596 8:91528459-91528481 TGCCACTACCACCACCTCCAAGG - Intergenic
1044792560 8:95863147-95863169 TACCCCAACCACCTCCTTTATGG + Intergenic
1048072140 8:131032519-131032541 TGCCACTACCTTCTCGATAAAGG - Intronic
1050114069 9:2244850-2244872 TGTCTCTTCCTCTTCCTTTAAGG - Intergenic
1052717141 9:32130313-32130335 TGCCACCACCGCCCCCTTTCTGG - Intergenic
1053141416 9:35685055-35685077 GGTCACTACCTCCTCCTCTGAGG + Exonic
1055573915 9:77644164-77644186 TGCCACTTCCTCTTCTTATAAGG - Intronic
1056770130 9:89472308-89472330 TGCCATCTCCTCCTCCTTTCTGG - Intronic
1057023343 9:91718131-91718153 TGGCACTGCCTGCTCCTGTACGG - Intronic
1059931393 9:119264422-119264444 TGCCACCTCCTCCACCTTTTTGG + Intronic
1059958897 9:119545998-119546020 TTCCACTCCTTCCTCCTTGAGGG - Intergenic
1061618304 9:131794308-131794330 AACCAGAACCTCCTCCTTTAGGG - Intergenic
1186509423 X:10119312-10119334 TCCCACCACCTTCTCCTTAAGGG + Intronic
1190951369 X:55147127-55147149 TGCCATTACCTTCTTCTTTTGGG - Intronic
1197151100 X:123220758-123220780 TGACACTACTTCCTACTTCATGG + Intronic
1197184273 X:123569541-123569563 TGACACTATCTTCTCCTTTCAGG - Intergenic
1197565780 X:128084146-128084168 TGCCACTCACCCCTCTTTTAGGG - Intergenic
1198384370 X:136114572-136114594 GGCCACTATCGCCTCCTTTCTGG + Intergenic
1200317297 X:155147478-155147500 TGCCCCCACCACCTCCCTTAGGG - Intronic