ID: 951869309

View in Genome Browser
Species Human (GRCh38)
Location 3:27342719-27342741
Sequence CACTAGATGCAGAAATTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951869309_951869316 17 Left 951869309 3:27342719-27342741 CCTAACAATTTCTGCATCTAGTG 0: 1
1: 0
2: 1
3: 20
4: 131
Right 951869316 3:27342759-27342781 GACCCAATAAATAGTCTACTGGG 0: 1
1: 0
2: 0
3: 9
4: 73
951869309_951869315 16 Left 951869309 3:27342719-27342741 CCTAACAATTTCTGCATCTAGTG 0: 1
1: 0
2: 1
3: 20
4: 131
Right 951869315 3:27342758-27342780 TGACCCAATAAATAGTCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951869309 Original CRISPR CACTAGATGCAGAAATTGTT AGG (reversed) Intronic
907754358 1:57296138-57296160 GAGTAAATGCAGATATTGTTGGG + Intronic
909116134 1:71539511-71539533 CCCTACATGCAGCTATTGTTTGG + Intronic
910444826 1:87289425-87289447 GACTTGATCCAGAAATTGATGGG + Intergenic
910562269 1:88603410-88603432 AACTAGATGCTGAAATTATAGGG - Intergenic
911340245 1:96627688-96627710 CATTTGATGCAGTAATTGTTTGG + Intergenic
912086983 1:106019966-106019988 CAATATATGCAGAAAATATTTGG + Intergenic
912590990 1:110819957-110819979 CAATAGATGCAGAAAGGTTTTGG - Intergenic
915270587 1:154750651-154750673 CACTAGATGGAGAGCTGGTTAGG + Intronic
916005805 1:160658969-160658991 CAATTTATGCAGAAATTTTTAGG + Intergenic
919604232 1:199661162-199661184 CACTGGATACAGAACTTCTTTGG + Intergenic
921474396 1:215589067-215589089 CATTTAATCCAGAAATTGTTTGG - Intronic
922894022 1:229086970-229086992 CTCTACAAGTAGAAATTGTTGGG + Intergenic
924374671 1:243392775-243392797 CATTAAATGCAGGAATGGTTGGG + Intronic
924375278 1:243401284-243401306 CTCAAGGTGCAGAAAATGTTTGG + Intronic
1066574709 10:36812779-36812801 CACTAAATGGAGAAATTGTTTGG - Intergenic
1067966152 10:50915143-50915165 CATGAGATGCAGACATTGCTTGG + Intergenic
1068613731 10:59089005-59089027 CAGTAGATGCAGACAATCTTGGG + Intergenic
1068902380 10:62282466-62282488 CAAAAGATGAAGAAATTGTTAGG - Intergenic
1074603672 10:114939389-114939411 CACAAGGTGCAGAAATTACTAGG - Intronic
1074657236 10:115605201-115605223 CACTGGATGCAGAAAAACTTTGG - Intronic
1074711084 10:116178136-116178158 AACTACATGCAGATCTTGTTTGG + Intronic
1074739563 10:116472077-116472099 AACTAGAAACAGAAAATGTTAGG + Intronic
1074863418 10:117530805-117530827 CAATAAATGCAGAAAAAGTTGGG + Intergenic
1077851775 11:6079902-6079924 CAGCATATGCAGAAATTTTTAGG - Intergenic
1079177079 11:18152396-18152418 CAGTTTATGCAGAAATTTTTAGG + Intronic
1079832458 11:25285579-25285601 TAATAGATGCACAATTTGTTGGG + Intergenic
1080382574 11:31789067-31789089 CTCTAGATGCACAAAATGATTGG + Exonic
1081141500 11:39506547-39506569 GAGTAGAGGCAGAAATTGTAGGG + Intergenic
1083897421 11:65627029-65627051 CACTAGAAGCAGTACTTGTCCGG - Exonic
1084017815 11:66396764-66396786 CACCAGATGGAGAAACTGTATGG + Intergenic
1086484299 11:87282042-87282064 CACAAGTTGCAGAGATTGTTGGG + Intronic
1088070369 11:105776706-105776728 CACTAAATGCAGTAATCTTTGGG - Intronic
1089149426 11:116353428-116353450 CACTTGGTTCAGAAATTGGTGGG + Intergenic
1091137923 11:133209237-133209259 CACTAGATGCGGAAATTCTAGGG - Intronic
1091679252 12:2514842-2514864 CATTAAATGAATAAATTGTTAGG + Intronic
1095682499 12:44994986-44995008 CACTAAGTGAAGAAAATGTTGGG - Intergenic
1097645609 12:62233047-62233069 AAAGAGATGCAGAAATTGCTGGG - Intronic
1099692615 12:85978456-85978478 CAGTATATGCAGAAAATTTTTGG - Exonic
1100325612 12:93537219-93537241 CACTGGCTGCATAATTTGTTGGG + Intergenic
1104548631 12:129734986-129735008 CATTAGATGCAGAAATAAATAGG + Intronic
1105414682 13:20199798-20199820 CACCAAATGCAAAAATAGTTTGG + Intergenic
1108166466 13:47698506-47698528 GTCTAGATGCAGAAATTGTATGG + Intergenic
1109081583 13:57908967-57908989 GACATGATGCAGAAAATGTTGGG - Intergenic
1112852296 13:103721199-103721221 CTCTAGATGCAGCCATTCTTGGG + Intergenic
1115139874 14:30158474-30158496 CACGTGATGCTGAAGTTGTTAGG - Intronic
1115205117 14:30894840-30894862 CATTAGTTGCACAAAATGTTTGG - Intronic
1115657774 14:35460285-35460307 CACTAGATTCTGAAGCTGTTTGG + Intergenic
1120063750 14:80015449-80015471 CTCGAGATGCAGAAATTATCCGG - Intergenic
1127401590 15:58592242-58592264 GTCTAGATCCATAAATTGTTGGG + Exonic
1128205291 15:65845982-65846004 CATCAGATGCAGAAAATTTTCGG + Intronic
1128996797 15:72303216-72303238 CCCAAGAGGCAGAAATTCTTGGG + Intronic
1131219824 15:90573320-90573342 TACTAGATGGAGAAAATATTTGG - Intronic
1133488463 16:6243726-6243748 CACTCCATTCAGAAATTGCTGGG + Intronic
1133881138 16:9783593-9783615 AACTAGAGGCATAAATGGTTTGG - Intronic
1135939413 16:26808401-26808423 CTCTAGGTGCAGAAATAGATGGG - Intergenic
1139718871 16:68836965-68836987 CACTAGATACAAAATTTATTTGG - Intergenic
1141232675 16:82184303-82184325 CACTAGCTGCTTAAATTGGTGGG - Intergenic
1150884429 17:69069270-69069292 CACTAGAGCCAGAAATTGGTAGG + Intergenic
1153039155 18:794742-794764 CAACAGAGGCAGAAATTGGTGGG - Intronic
1157405565 18:47419762-47419784 CACTAGATGGAGAAGGTGCTGGG + Intergenic
1157896130 18:51470079-51470101 CAATAGATGCAGAAAAACTTTGG - Intergenic
1159156280 18:64587418-64587440 CAGGGGCTGCAGAAATTGTTGGG + Intergenic
1163127534 19:15252329-15252351 CCCCAGATGCTGAAATTGTCAGG - Intronic
931034525 2:58223793-58223815 CACTATATGCAGTAATTACTAGG + Intronic
931182137 2:59913371-59913393 AACTAGATATAGAAATGGTTGGG - Intergenic
932992262 2:76801885-76801907 CAATAGATGCAGAAATGCATTGG + Intronic
934164624 2:89282810-89282832 CACCAGATTCAGAGAATGTTGGG - Intergenic
934202650 2:89899714-89899736 CACCAGATTCAGAGAATGTTGGG + Intergenic
934666817 2:96177526-96177548 CAGTAGATGTAGAATTTATTTGG - Intergenic
940079458 2:149783885-149783907 CAATACATCCAGAAATTGTTTGG + Intergenic
941225617 2:162843167-162843189 CAGAAGAGGCAGAAATTTTTAGG + Intergenic
941389899 2:164898763-164898785 CACTAGATGGAAACATTCTTCGG + Intronic
943643170 2:190381088-190381110 CACTTAACGCAGAAAGTGTTTGG - Intergenic
943693567 2:190896500-190896522 AAGTAGATGCAGAAATTTTTTGG - Intronic
946475515 2:220003028-220003050 CACTGGATTCACAAATTGTGAGG - Intergenic
946991683 2:225338105-225338127 CATTAGATGCAGAATCTGTTTGG - Intergenic
947430083 2:230020494-230020516 CACAAAATGCAAAAATTATTTGG - Intergenic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1170077188 20:12432537-12432559 CACTAGTTGCAGACACTGCTTGG + Intergenic
1172240907 20:33412011-33412033 CTCTGGAGGCAGAAACTGTTGGG + Intronic
1172539973 20:35704704-35704726 CAATAGCTGCAGCAATTGATGGG + Exonic
1177348932 21:19910048-19910070 CAGTTGATGCAGAAATTGCCAGG + Intergenic
1178045386 21:28687856-28687878 CAATAAATGCACAAAATGTTGGG - Intergenic
1178382594 21:32123301-32123323 GACTAGATGCTGAGATTCTTTGG + Intergenic
951226116 3:20123270-20123292 CAGTACATGCAAAAATAGTTAGG - Intronic
951796232 3:26541620-26541642 CACTTGATGAAGAAATTATTTGG + Intergenic
951869309 3:27342719-27342741 CACTAGATGCAGAAATTGTTAGG - Intronic
952238371 3:31504174-31504196 AGCTAGATGAAGAAATTGTCTGG + Intergenic
954312442 3:49780640-49780662 CACTGGATGCAAACATTTTTAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956452505 3:69388426-69388448 CCCTGGAATCAGAAATTGTTGGG + Intronic
957362579 3:79178297-79178319 CAGTAAATGAAGAAATTATTAGG + Intronic
957461644 3:80529190-80529212 TTCTAGAGGCAGAAATTTTTAGG - Intergenic
957960577 3:87245772-87245794 CCGTAGATGCACAAGTTGTTTGG - Exonic
962132821 3:132700276-132700298 ATTTAGATTCAGAAATTGTTGGG - Intronic
965203316 3:165689212-165689234 CACTTGATACAGGAATTGTTAGG + Intergenic
970328613 4:14955535-14955557 CACAAGAGGGAGAAATTCTTAGG - Intergenic
973026314 4:45276587-45276609 GACTAGATTCATAAATAGTTTGG - Intergenic
973344322 4:49037939-49037961 CACTATATGCAGATAGTCTTTGG + Intronic
975183876 4:71378555-71378577 CATTAAATCCAGACATTGTTTGG - Intronic
981332445 4:143527575-143527597 CACTAGATCGGGAAATTCTTAGG - Intronic
982222514 4:153137125-153137147 CACTGGATGCAGAAGGAGTTGGG - Intergenic
982656806 4:158160344-158160366 CCCTAGATTCAGGACTTGTTTGG - Intronic
982802134 4:159718599-159718621 CACAAGATCCAGAGTTTGTTAGG + Intergenic
983840207 4:172448833-172448855 CACCAGGGGCAGAAATTGTTAGG + Intronic
983842379 4:172473111-172473133 CAAATGATGCAGAAGTTGTTAGG - Intronic
986946515 5:13028614-13028636 TATTAGATCCAGAAATTATTTGG - Intergenic
989422643 5:41257567-41257589 CACTTGATGAATAAAGTGTTTGG + Intronic
992951753 5:81865207-81865229 CACTAAATGCAGACCTAGTTGGG + Intergenic
992981625 5:82180627-82180649 CACAAGACCCAGAAAATGTTTGG + Intronic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
995549972 5:113271298-113271320 CACTAGATTCACAAATGGTTGGG + Intronic
995585489 5:113643899-113643921 CACTCGTTGCAGAGATTGATGGG + Intergenic
996860555 5:128061151-128061173 CACTAAATGCAGAAACTACTGGG + Intergenic
998768938 5:145520031-145520053 CACTAGGTGCTCAAATTGGTCGG - Intronic
999336140 5:150718627-150718649 TACTAGATCCAGAAATTCTGAGG + Intronic
1002955147 6:1855140-1855162 CACCATATGCAGAGATTGTTTGG - Intronic
1004416348 6:15427769-15427791 CACTAGATGCTGGAATTGTGAGG + Intronic
1006466629 6:34198915-34198937 CAATAGATACACAAATAGTTAGG - Intergenic
1008968960 6:57344736-57344758 AACTATATGCATAAATGGTTAGG - Intronic
1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG + Intergenic
1018285385 6:162232189-162232211 CAGGAGATGCAGAAATTGTCAGG - Intronic
1019764602 7:2841328-2841350 CAGTAGATGGAGAAAGTATTTGG - Intronic
1022755879 7:33289045-33289067 CAGTAAAAGCAAAAATTGTTGGG - Intronic
1023178936 7:37461652-37461674 CAGTAGATGCTAAAATTATTGGG - Intergenic
1023287581 7:38634887-38634909 CTCTGGTTGCAGAAAGTGTTGGG + Intergenic
1028826608 7:95280951-95280973 CAATAGAAGCAGAAAGGGTTTGG - Intronic
1030571679 7:111233962-111233984 CCCCACAAGCAGAAATTGTTTGG + Intronic
1031774355 7:125888537-125888559 GACTAGGTGCAAAAATGGTTGGG - Intergenic
1032007034 7:128310849-128310871 CAATATAAGCAGAAATTATTGGG - Exonic
1034022822 7:147663595-147663617 TGCTACAGGCAGAAATTGTTTGG - Intronic
1037088852 8:14887440-14887462 AACTAGATGCATATATTTTTAGG + Intronic
1037180278 8:15996555-15996577 CCATAGATACAGGAATTGTTGGG + Intergenic
1038223406 8:25632132-25632154 CAGTACATGCAGAAATTTTTAGG + Intergenic
1038735501 8:30165499-30165521 GACAAGATGCCTAAATTGTTTGG - Intronic
1038895306 8:31776113-31776135 CACTAGAAGCTCAAATTTTTAGG + Intronic
1039223668 8:35363808-35363830 CACTAGATGCTAAAATTAATGGG - Intronic
1042777920 8:72455188-72455210 TATTAGATCCAGAAATTTTTTGG + Intergenic
1045691909 8:104767936-104767958 CATTAGATTCAGAAAATGCTAGG + Intronic
1046269925 8:111881503-111881525 CACCATTTGCACAAATTGTTAGG + Intergenic
1046678608 8:117141429-117141451 CACTAGATGCAGAAAACGAATGG + Intronic
1050743211 9:8846471-8846493 CACTATATGTAGAATTTATTCGG + Intronic
1051532514 9:18120434-18120456 GACTAGAGGTAGGAATTGTTGGG + Intergenic
1055175135 9:73309326-73309348 CAATAGAGGTAGAAATTGATTGG - Intergenic
1055871152 9:80881444-80881466 CAGCATATGCAGAAATTGTGCGG - Intergenic
1058852158 9:109023311-109023333 CTAGAGATGCAGAAATTATTTGG + Intronic
1188861800 X:35266781-35266803 CAATAGCTGCAAAAATTGTTAGG - Intergenic
1189939103 X:46102833-46102855 CAATAGATGCAGAAAGGCTTTGG - Intergenic
1191699979 X:64031470-64031492 CCCTTGATGCTGAAATTGTTTGG + Intergenic
1193883105 X:86950935-86950957 CAATAGATGCAGAAAATTTATGG + Intergenic
1194738024 X:97537574-97537596 CAATAGAAGGAGAAATTGATGGG + Intronic
1198945650 X:142010534-142010556 CAATAGATGCAGAAAAGGTTTGG - Intergenic
1199806575 X:151306295-151306317 CTGGAGATGCAGAACTTGTTGGG - Intergenic