ID: 951878057

View in Genome Browser
Species Human (GRCh38)
Location 3:27450151-27450173
Sequence TCACCTTTTAAATTAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951878054_951878057 1 Left 951878054 3:27450127-27450149 CCAATATATTAACCTCATAAATA 0: 1
1: 0
2: 4
3: 46
4: 381
Right 951878057 3:27450151-27450173 TCACCTTTTAAATTAAAAGAGGG 0: 1
1: 0
2: 4
3: 50
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951878057 Original CRISPR TCACCTTTTAAATTAAAAGA GGG Intronic
900677663 1:3898702-3898724 TTGCTTTTTAAATTAAGAGAAGG - Intronic
907150166 1:52278299-52278321 TCACTTTTGAGAGTAAAAGAGGG + Intronic
907253574 1:53160853-53160875 TCAACTTTGAAAATTAAAGAAGG - Intergenic
907867708 1:58414680-58414702 TCATCTTTAAAATTAAAGGAAGG - Intronic
907964145 1:59312907-59312929 TATCCTTTTAAATTTAAAGTTGG - Intronic
908428546 1:64032811-64032833 TCAACTTTTAAAGTCAAAGATGG + Intronic
909139329 1:71843989-71844011 TCTCCAGTTCAATTAAAAGAAGG - Intronic
909286003 1:73818651-73818673 TCACTTTTTTATTGAAAAGAGGG + Intergenic
909858965 1:80579309-80579331 TAACATTTTGAATGAAAAGAAGG + Intergenic
910573204 1:88729201-88729223 TAACAATTTAATTTAAAAGACGG - Intronic
910660822 1:89670755-89670777 TCACAATCTAAATTTAAAGATGG - Intronic
911544374 1:99199287-99199309 ATACTTTTTAAATTAAAAGGAGG + Intergenic
911960578 1:104297168-104297190 TCAAGGCTTAAATTAAAAGATGG + Intergenic
912110549 1:106335584-106335606 TCAGCTTTAAAATTATAAAAGGG - Intergenic
912672869 1:111647724-111647746 TCATCTCTTAATTTAAAAGAAGG - Intronic
913044872 1:115065345-115065367 CCACATTTTAAATTCCAAGATGG + Intronic
913695501 1:121321233-121321255 TCACATTTCAATTTAAAAAACGG - Intronic
914142064 1:144958827-144958849 TCACATTTCAATTTAAAAAACGG + Intronic
915376694 1:155402488-155402510 TAATCTTTTAAATAAAAAAAAGG + Intronic
916317187 1:163462414-163462436 ACACCTTTACATTTAAAAGAAGG - Intergenic
917569378 1:176248910-176248932 TCAACTTTTTTGTTAAAAGATGG - Intergenic
917934664 1:179853761-179853783 TAAGCTTTTAAGTTAAAATATGG - Intronic
918731913 1:188009394-188009416 TTACCTTTTATATTATAATATGG - Intergenic
920482830 1:206339616-206339638 TCACATTTCAATTTAAAAAACGG - Intronic
921329750 1:214023785-214023807 TAACATTTTAAATTAGAATATGG + Intronic
921460794 1:215424041-215424063 TCAATTTTTAAAATAAAAGATGG - Intergenic
921540501 1:216408649-216408671 TTACCTTTTCACTTAAAAGAGGG + Intronic
921979608 1:221241580-221241602 TACCTTTTTAAATTAAAAAACGG - Intergenic
922645041 1:227277175-227277197 TAAACTTTAAAATTAAAAGTGGG + Intronic
923627208 1:235623725-235623747 TCACCTTTTAAATTCAGAGCGGG + Intronic
923854711 1:237833732-237833754 TCAGCTTTGATATTAAAAAATGG - Exonic
924604798 1:245523758-245523780 TCAACTTATGAATTTAAAGAGGG + Intronic
1063073583 10:2691526-2691548 TCTCCTTATAAAATAAAAGTGGG - Intergenic
1063549171 10:7013032-7013054 TCACCTTTATAATCAAAAGATGG + Intergenic
1064710401 10:18118173-18118195 TTACCTATTAAGTTATAAGATGG + Intergenic
1064860946 10:19824823-19824845 CCACCTTTTTAATTAAAAAGAGG - Intronic
1064973529 10:21089900-21089922 TCATTTTTAAATTTAAAAGAAGG - Intronic
1065725304 10:28662973-28662995 CCACTCTTTAAATTAAATGATGG - Intergenic
1065812895 10:29458794-29458816 TTAAATTTTAAATTAAAAAATGG + Intronic
1066025960 10:31361418-31361440 TTACTTTTTAATTTAAAAAAAGG - Intronic
1067847678 10:49736654-49736676 ACACCTCTTGAACTAAAAGATGG + Intronic
1068766360 10:60768695-60768717 TCAGCATTCAATTTAAAAGAAGG + Intergenic
1068772953 10:60842571-60842593 TAAAATTTTAAATTAAAATATGG - Intergenic
1069244844 10:66191412-66191434 TCACCTTGGAAGTTAAAGGATGG - Intronic
1070949683 10:80420725-80420747 TTATCTTTTCAATTAAAAAAAGG - Intronic
1072991090 10:100194636-100194658 TCTCCATTTAAATTAAAAATTGG + Intronic
1074060444 10:109960539-109960561 TCATCTTTTCATTTAAAAAATGG - Intergenic
1075642607 10:124075668-124075690 TCAGGTTTTAAATTGGAAGAGGG - Intronic
1075935721 10:126339568-126339590 TCTCCTTTAAGATTGAAAGAGGG - Intronic
1076270233 10:129146267-129146289 TCACCCTTGAAATTAAACGCTGG - Intergenic
1077891923 11:6424984-6425006 TTGCCTTTTTAATAAAAAGATGG + Intergenic
1079120400 11:17679786-17679808 TCACCAATCACATTAAAAGATGG - Intergenic
1080156897 11:29121654-29121676 TCACCTTCTTAACTTAAAGATGG + Intergenic
1080219660 11:29886672-29886694 TCACCTTTTACAGTGAATGAAGG - Intergenic
1080904335 11:36525772-36525794 TCACTTTTTAAATTCTAGGAGGG + Intronic
1080986674 11:37475410-37475432 TCAACTGTAAAATTAAAAGGAGG + Intergenic
1081046940 11:38286615-38286637 TCATTTTTTAAATTAAGAAAGGG - Intergenic
1085585219 11:77696628-77696650 TGTCCCTTTAAACTAAAAGAGGG - Intronic
1085898410 11:80667295-80667317 TAACCTTTGAAATGCAAAGAGGG + Intergenic
1085936317 11:81149947-81149969 TCAGATTTTTAAATAAAAGATGG - Intergenic
1085951127 11:81332512-81332534 TCATCTGTTAAATAAAATGATGG + Intergenic
1086610943 11:88754764-88754786 TCCCCTCCTAAATTCAAAGATGG + Intronic
1087148145 11:94832706-94832728 TCACCTTTCAAATGAAACCAAGG - Intronic
1087630317 11:100642576-100642598 TCACTTTGTTTATTAAAAGAAGG + Intergenic
1088472751 11:110203802-110203824 TTTCTTTTTAAATAAAAAGAGGG - Intronic
1088629505 11:111761115-111761137 TCACCTTTTAAAGTGACTGAAGG + Intronic
1090059782 11:123454285-123454307 TCCCCTTTAAATTTAAGAGAAGG + Intergenic
1090453885 11:126830509-126830531 TCACATTTACAATTAAATGAGGG + Intronic
1090957527 11:131526650-131526672 TCACCTGTTAATTAAAAAGTAGG - Intronic
1093227153 12:16498891-16498913 TCTCCTTTTTAAGTCAAAGATGG - Intronic
1093700712 12:22217357-22217379 TCACCATTTAAGTAAAAAAATGG + Intronic
1095075089 12:37910267-37910289 TGACCTTTTCCATCAAAAGAAGG + Intergenic
1095670431 12:44853521-44853543 TTGCCTTTCAAATGAAAAGAGGG - Intronic
1096713233 12:53473495-53473517 TCACAATTTAAATTACATGAAGG - Intronic
1096949924 12:55457531-55457553 TCATATTTGAAATTAAAAGTTGG + Intergenic
1097753750 12:63386509-63386531 TCAGTTTTTAAATTATAAGGAGG - Intergenic
1098241463 12:68471489-68471511 TCTGCTTTTAAATTAAAAATGGG - Intergenic
1098476726 12:70912976-70912998 TCCCCTTTTAAAGGAAAAAATGG + Intronic
1098819710 12:75211563-75211585 TCTCTATTTAAATTAAAAGGGGG - Intergenic
1098890032 12:76000762-76000784 TCTCATTTTAAATCAAAAGCTGG - Intergenic
1099457462 12:82881408-82881430 TCAAATTTCACATTAAAAGAGGG + Intronic
1099689430 12:85933530-85933552 TCAGCTTTTAATATAAAATAAGG - Intergenic
1102801077 12:115734468-115734490 ACAAATTTTAAATTCAAAGAGGG - Intergenic
1103054846 12:117810611-117810633 TCACCTTTAAAATTGAGACAGGG - Intronic
1103585525 12:121951512-121951534 TCACTTTTTCAGTTAAAAGTGGG - Exonic
1104130518 12:125889271-125889293 TCACTTATTAACTAAAAAGATGG + Intergenic
1105578258 13:21672416-21672438 CCCCCCTTTAAATTAAAAGTAGG - Intronic
1106672575 13:31922343-31922365 GCAACATTTAAATTAAAAGAAGG - Intergenic
1106943964 13:34804962-34804984 TGACTTTTTAAATTAAATTAGGG - Intergenic
1108148441 13:47504660-47504682 TACTCTTTTAAAATAAAAGAGGG + Intergenic
1108331129 13:49385593-49385615 TCTCACTTTAAATCAAAAGATGG - Intronic
1109053989 13:57523045-57523067 TCAACTATTAAATTGTAAGATGG - Intergenic
1109341794 13:61071132-61071154 TCACATTTTAGCATAAAAGAGGG - Intergenic
1109953296 13:69531084-69531106 TCTCGTTTTAAATAAAAAGCTGG + Intergenic
1110200884 13:72848963-72848985 GCACTTTTTAGAATAAAAGAGGG - Intronic
1110289124 13:73784109-73784131 ACTCCCTTTAAATTAAAAGAAGG + Intronic
1110981712 13:81908647-81908669 GCACCTTTATAAGTAAAAGAAGG + Intergenic
1111840869 13:93449519-93449541 TCCCTTTTTTAATTTAAAGAGGG - Intronic
1111847311 13:93527659-93527681 TCACTTTTTCAATTAATAAAGGG - Intronic
1111983786 13:95044808-95044830 TAATCTTTTAACTAAAAAGAAGG - Intronic
1112256064 13:97832291-97832313 TCATCATTTCAATTAAAAAATGG - Intergenic
1112844553 13:103623585-103623607 TCATTTTTTTAATTAAAAAAAGG - Intergenic
1113209920 13:107965194-107965216 TTATCTTTTCAATTAAAAGGTGG + Intergenic
1113408811 13:110065617-110065639 TTACCTTTTAAAAAAAAAAATGG + Intergenic
1115047215 14:29010411-29010433 AGACTTTTTAAATTATAAGAAGG - Intergenic
1115142202 14:30184861-30184883 TCACGTTTTGAATTAAATAAAGG + Intronic
1115790071 14:36868587-36868609 TCACTTTGTATTTTAAAAGATGG - Intronic
1116189411 14:41644908-41644930 TGACATTCTAAATTAAAACATGG + Intronic
1116453121 14:45086291-45086313 AGACCTTTTAAATTTTAAGATGG + Intronic
1116871314 14:50071242-50071264 TCACCTGTAAAATTAGGAGAGGG - Intergenic
1117295165 14:54372378-54372400 TCACTTTTTAAATTAACAAAGGG - Intergenic
1118560444 14:67074597-67074619 TCTCATTTTAAATCAAAAGCTGG + Intronic
1118585127 14:67345252-67345274 TAAATTTTTAAATTAAAAGTAGG + Intronic
1119130832 14:72171607-72171629 TCACCTTCTGAAGTAAAAGAAGG + Intronic
1120217768 14:81698539-81698561 TAAACTTTTTTATTAAAAGAGGG - Intergenic
1120352037 14:83373925-83373947 TTGCCTTTTAAATTATAACATGG + Intergenic
1120369146 14:83609736-83609758 TTACCTTTTAACTAAAATGAAGG + Intergenic
1120524810 14:85565661-85565683 TTAGCTTTTAAAATAAAAGTTGG + Intronic
1121468409 14:94130711-94130733 TCACCTATTAAATCAACAAAGGG - Intergenic
1123905666 15:24918258-24918280 ACACATTTTATCTTAAAAGATGG + Intronic
1123990848 15:25682253-25682275 TCACTTTTAAAATTACACGATGG + Intronic
1124949436 15:34303046-34303068 TCACATTTTCATTTTAAAGATGG + Intronic
1125400396 15:39296091-39296113 TCTCCTTTTGAAAGAAAAGAAGG - Intergenic
1126589912 15:50328189-50328211 TGACATTCTAAATTAAAAGCTGG + Intronic
1127038082 15:54941865-54941887 TCAGCTTATAAAGTAAAACACGG + Intergenic
1127126343 15:55815903-55815925 TTAGCTTTTAAATTAAGATAAGG + Intergenic
1127404627 15:58629733-58629755 TCACATTTTAATTTAAAATTTGG + Intronic
1127743664 15:61940054-61940076 ACACCTTTCTAATTAAAACAAGG + Intronic
1127746809 15:61985555-61985577 TAACCTTTAAAACTAAGAGAGGG - Intronic
1128439832 15:67695794-67695816 TCACATTTTCAATTAACAGATGG - Intronic
1128453173 15:67818882-67818904 AAATCTTTTAAAGTAAAAGAGGG - Intergenic
1129306167 15:74664874-74664896 GAACCTTTTAAATGGAAAGATGG - Intronic
1129575622 15:76741332-76741354 TCACTTTTAAAATAAAAATATGG + Intronic
1130359940 15:83174055-83174077 TCACAATTTAAATCAAAAGTAGG - Intronic
1131743561 15:95420854-95420876 TGACCTGTAAAATTAAAAGGAGG + Intergenic
1132435738 15:101800347-101800369 TCAACTTTTACTTTAAAATAAGG - Intergenic
1133776594 16:8900736-8900758 TAACATTTTAACTTAAAAGGTGG - Intronic
1134646373 16:15870804-15870826 TCATCTCTAAAATTAAAAAAAGG + Intronic
1135119641 16:19754696-19754718 TCAGGTTTTTAATTATAAGAAGG - Intronic
1135379596 16:21983791-21983813 TCAACATTTACAGTAAAAGAAGG + Intergenic
1137045830 16:35659837-35659859 CAACCTTTTGAATTAAAACAAGG - Intergenic
1137741244 16:50777430-50777452 TAACCTATTATTTTAAAAGAAGG - Intronic
1138169936 16:54839431-54839453 TAACCATTTAAAAAAAAAGAGGG + Intergenic
1138867191 16:60836242-60836264 TCATTTTTTAAAATAATAGAAGG - Intergenic
1138920940 16:61528224-61528246 TCATCTTTTCAATTAATAAAAGG + Intergenic
1138964548 16:62068425-62068447 TCTCCTTTTAAATTAAAATTGGG + Intergenic
1139165179 16:64557379-64557401 ACACCTTTTAAAATAAAAACTGG + Intergenic
1140072128 16:71660195-71660217 ACACTTTTCAAATTAAAAAATGG + Intronic
1140207152 16:72942741-72942763 TCACCATTTATCTTAAAAAAGGG - Intronic
1141042787 16:80686323-80686345 AAACTTTTTCAATTAAAAGAAGG + Intronic
1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG + Intergenic
1143573199 17:7774078-7774100 TCACCTTTTCACTTAAAGGAAGG + Intronic
1143820556 17:9558139-9558161 TAACCTGTTACATTAAAGGATGG + Intronic
1143836447 17:9696620-9696642 TCACCATTTAAACACAAAGATGG - Intronic
1143858155 17:9868050-9868072 TCACCATTTAAAGCAGAAGATGG - Intronic
1144261148 17:13522076-13522098 CCACTTTTTAAATTAAATGTTGG - Intronic
1145827711 17:27889630-27889652 TGACCTCATAAAATAAAAGATGG - Intronic
1146247344 17:31300378-31300400 TCACCTTTTATATTAGAAGGGGG - Intronic
1146467470 17:33097501-33097523 TCACCTTTCAGATGAAAAAATGG + Intronic
1148702380 17:49596716-49596738 TCACCTCTGAAATTAAAAGAAGG + Intergenic
1149408230 17:56376826-56376848 TGACCTTATAAATTAACACAAGG - Intronic
1149573536 17:57695185-57695207 TTACCTTTCGAATTAAAAGTAGG + Intergenic
1149958149 17:61076587-61076609 TCAACTTTTCAATTAGAAAAAGG + Intronic
1150734372 17:67723700-67723722 TGACCTTTTAAATTTAAGGCTGG + Intronic
1152276464 17:79360683-79360705 TAACCCTATAAATTAACAGATGG - Intronic
1153142616 18:1991911-1991933 TCACCTTTTAAGAGAAACGAAGG - Intergenic
1153360080 18:4184667-4184689 TTCCCTTTTATCTTAAAAGAAGG - Intronic
1153474903 18:5488784-5488806 TCAGTGTTTTAATTAAAAGAAGG + Intronic
1154295652 18:13144671-13144693 TCACATTTTATAGCAAAAGAGGG - Intergenic
1155265417 18:24088210-24088232 TCACATTTTTATTTCAAAGATGG + Intronic
1155697919 18:28705910-28705932 GCACCCTCTAATTTAAAAGATGG + Intergenic
1156027978 18:32678178-32678200 TCACCCTCTAAATTAAAGGCAGG - Intronic
1156097138 18:33548425-33548447 CCACCTTTGAAAACAAAAGATGG - Intergenic
1156960028 18:43016087-43016109 TCACTTTTTTAATTAGAAGCTGG - Intronic
1157007214 18:43597397-43597419 TCATTTTTTAAATAAAAAAATGG + Intergenic
1157703663 18:49782378-49782400 TCAGCTTTTTAATCAAATGAAGG + Exonic
1157852670 18:51071300-51071322 TCCCCTTTTTAATTAAAATGAGG + Intronic
1158300127 18:56042671-56042693 ACACATTTTAAAGTGAAAGACGG + Intergenic
1158759341 18:60365963-60365985 TCACTTTTTGAATTTAAATATGG - Intergenic
1158775802 18:60577813-60577835 GCACTTTTAAAATTAAGAGATGG - Intergenic
1163064299 19:14781789-14781811 TCAGTTTTTAAATTTAAAAAAGG - Intergenic
1165604269 19:37086829-37086851 GCACATTTTAAATATAAAGATGG - Intronic
1167689955 19:50979384-50979406 TCACATTTTAAATAAAGAGCAGG - Intronic
925101994 2:1255033-1255055 GCACCTCTTATGTTAAAAGAGGG - Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926047798 2:9722704-9722726 TCAACTTTTCAATAAAATGAAGG + Intergenic
926609744 2:14934472-14934494 TCTACTTTTAAATTAAACTACGG - Intergenic
926637111 2:15193236-15193258 TCACATTTTTAGTTAAAATATGG - Intronic
927690760 2:25206577-25206599 TCATCTTATCAATTAAAAGAGGG + Intergenic
927725980 2:25423642-25423664 ACCCCTTTTAAATTAAAATTAGG + Intronic
928031100 2:27780135-27780157 TTTCCTTTTAAAATAAAAGAAGG + Intronic
928051744 2:28004583-28004605 TCACTTTTTAAAATCAAAGGAGG + Intronic
928747180 2:34428847-34428869 CCACCTTACAAATTAAAGGAGGG + Intergenic
928990577 2:37229492-37229514 TCATCTGATAAATTAAAAGATGG - Intronic
929336882 2:40759401-40759423 TCACTTTTTAAACTAAGAGTGGG - Intergenic
929753838 2:44746624-44746646 TCAACTTTGAAATAAACAGAAGG + Intronic
929997956 2:46840783-46840805 TCTCCATTTAAAAAAAAAGATGG - Intronic
930296976 2:49566705-49566727 TCACAGTTTAAATTTAATGATGG + Intergenic
930992412 2:57673409-57673431 TTATCTTTTAAATAAAAATATGG + Intergenic
932061429 2:68503443-68503465 TCAGCTTTTAAATTATAGAATGG + Intronic
932647545 2:73519540-73519562 TAACATTCTAAATTAAAAGTAGG + Intronic
933107337 2:78347521-78347543 TCAGCTTTTAATTTTAGAGAAGG - Intergenic
933465716 2:82648311-82648333 TCAACTTTTATATTAAATTATGG - Intergenic
933556996 2:83843170-83843192 TCACCTATTATTTCAAAAGATGG + Intergenic
934707793 2:96496942-96496964 TCAACTTCTAACTTAGAAGAAGG - Intergenic
935244760 2:101208377-101208399 TCACCTTAGAAATAAACAGAAGG + Intronic
935499824 2:103825195-103825217 ACAACTTTTAAATTAGAAGAAGG + Intergenic
936716531 2:115193306-115193328 TCATCTTTGACATTAAAAAAAGG - Intronic
936854634 2:116942069-116942091 TCAACTTGTCAATTCAAAGATGG - Intergenic
937142600 2:119614757-119614779 TCATCGTTGAAATTAAAAGTTGG - Intronic
937678333 2:124616696-124616718 TCTCATTTTAAATCAAAAGCTGG - Intronic
937742449 2:125372143-125372165 TCACTTTTTAAATTAAATCAGGG - Intergenic
938942226 2:136179346-136179368 TCAACTTTTAAATGAAAAAATGG + Intergenic
939595448 2:144117127-144117149 TCACCTGTTAAATATATAGAAGG - Intronic
940570787 2:155430311-155430333 TCAGGTTAAAAATTAAAAGATGG - Intergenic
941346005 2:164370676-164370698 TCACTTTTTAAATTTAAACTGGG - Intergenic
941790094 2:169542692-169542714 TTATCTTTTAAATTTAGAGATGG - Intronic
941969110 2:171330920-171330942 TCTACTTTTAAAGTTAAAGAGGG - Intronic
942136743 2:172933756-172933778 TCACCTTTTAAATTAATAAAAGG + Intronic
942656596 2:178220255-178220277 TCATTTTTTAACTTAAAAAAAGG - Intronic
942768945 2:179491998-179492020 TCATATTATAAAATAAAAGATGG - Intronic
942875325 2:180788930-180788952 TCACATGTTAAATAAGAAGATGG - Intergenic
943308430 2:186296792-186296814 TTACATTTTAAATGAAAATATGG + Intergenic
943580711 2:189680878-189680900 TTACCTTTAAATTTAAAAAATGG - Intronic
944090694 2:195907288-195907310 TCAACTTGTAAATAAAAAGCAGG - Intronic
944888212 2:204087164-204087186 CTACCTTTTACATAAAAAGAGGG - Intergenic
944935923 2:204567936-204567958 TAACTTTTTATATTTAAAGATGG - Intronic
945037529 2:205716843-205716865 ATAGCTTTTAAATTAAAATAAGG + Intronic
945092065 2:206184899-206184921 TTACATTGTATATTAAAAGATGG + Intronic
945305148 2:208253318-208253340 TCACTGTTTTAGTTAAAAGATGG - Intronic
946030422 2:216699391-216699413 CCCCCTGTTAAATTAAAAAAAGG + Intergenic
947065796 2:226224002-226224024 TAAGCTTTTAAATTAATGGAGGG - Intergenic
947180798 2:227409691-227409713 TTCCCTTTGAAATTAAGAGAAGG + Intergenic
947373387 2:229470905-229470927 TCACCTTTTAGAATCAAAGCAGG - Intronic
947477236 2:230461342-230461364 TCAACTTTTGAATTAGAAAATGG - Exonic
947562392 2:231168084-231168106 TTTCTTTTTAAATTAAGAGATGG - Intronic
947927545 2:233934893-233934915 TCACATTTTCATTTACAAGATGG - Intronic
948506540 2:238431623-238431645 TCTCACTTTAAATTAAAAGCTGG - Intronic
1169159772 20:3367495-3367517 TCTCATTTTAAATCAAAAGCTGG - Intronic
1170955931 20:20979300-20979322 TCACCAGTTAGAATAAAAGATGG + Intergenic
1171253361 20:23667634-23667656 ACACCTTTTATATTATTAGAAGG + Intergenic
1171259836 20:23722888-23722910 ACACCTTTTATATTATTAGAAGG + Intergenic
1174219332 20:48940283-48940305 TCAACTGTAAACTTAAAAGATGG + Intronic
1174232668 20:49059376-49059398 TCAGCTGTTAAGTTAAATGAGGG + Intronic
1175401955 20:58706061-58706083 TCATATTTTAAATTAACAGCAGG - Intronic
1175701630 20:61142371-61142393 GCATCCTTTAATTTAAAAGAGGG - Intergenic
1175836350 20:61997930-61997952 TCACCGTTGAATTTAAAAGTAGG + Intronic
1175885030 20:62285199-62285221 TTTCCTTTTTAAATAAAAGAGGG - Intronic
1176005155 20:62857914-62857936 ACACCTGTTAATTAAAAAGAGGG - Intronic
1178063609 21:28878862-28878884 TCACACTTTAAACTACAAGAGGG - Intronic
1179425952 21:41278690-41278712 TCACCTCTTAAATGAAATGATGG - Intronic
1179634515 21:42699026-42699048 TCGTTTTTTAAACTAAAAGAAGG + Intronic
1181415047 22:22753314-22753336 TCACCTTGTAAATGAAGAGCTGG - Intronic
1181773212 22:25141730-25141752 TCACCTCTTTAAATAAAAGGTGG - Intronic
1181832289 22:25570380-25570402 TCTCCTTTTTATTTAAAAAAGGG + Intronic
1183210574 22:36448854-36448876 TCACTTTGAAAATTAAATGAAGG - Intergenic
949630063 3:5915801-5915823 TCACCTTGTAATTTACAACAGGG + Intergenic
950229202 3:11261289-11261311 GCACGTTAAAAATTAAAAGAAGG + Exonic
950594512 3:13967347-13967369 TCATCTTTGACATTAAAAAAAGG - Intronic
951269334 3:20606023-20606045 ACATTTTTTAAATTAGAAGATGG + Intergenic
951325341 3:21296082-21296104 ACACATTTTAAATAAAAAGTAGG + Intergenic
951356748 3:21676662-21676684 TCACCTGTAAAATGAAAATAAGG - Intronic
951517455 3:23577157-23577179 TCTCACTTTAAATTGAAAGATGG + Intronic
951567086 3:24021316-24021338 TCTCCTTTTAAACTAAATTATGG + Intergenic
951878057 3:27450151-27450173 TCACCTTTTAAATTAAAAGAGGG + Intronic
952531391 3:34265628-34265650 TCACCTTTTCATTTTAGAGAAGG + Intergenic
952870794 3:37899281-37899303 TCACTTTACAATTTAAAAGATGG - Intronic
953089478 3:39709623-39709645 TCACATTGTTAATTAAAGGATGG - Intergenic
953204433 3:40811107-40811129 TATCCTTTTAAAACAAAAGAAGG - Intergenic
953222262 3:40983090-40983112 TCAGCTTTTAATTTTAATGATGG - Intergenic
954158857 3:48705367-48705389 TAAACTTTTAAGTTATAAGAAGG + Intronic
954773241 3:52993014-52993036 TCATCCTTTAATTTAAAAGAGGG + Intronic
954788221 3:53110870-53110892 TCACTTTTTAAATTAAAGCTGGG + Intronic
954923368 3:54211171-54211193 TCACATGTTAAAAAAAAAGAGGG - Intronic
954933922 3:54309478-54309500 TCAGGTTCTGAATTAAAAGATGG - Intronic
955085625 3:55699745-55699767 TTCCCTTTTAAATCACAAGAAGG - Intronic
955258290 3:57357727-57357749 TGACCTGTTAAGATAAAAGAAGG - Intronic
955716221 3:61833145-61833167 CCACCCTTCAAATAAAAAGAAGG - Intronic
955902608 3:63773532-63773554 TCACCTTTTAAAATGAAATTTGG - Intergenic
956645419 3:71450736-71450758 TCATTTTTTTAATTTAAAGAGGG + Intronic
957218726 3:77354690-77354712 TAACATGTAAAATTAAAAGATGG + Intronic
957605747 3:82396613-82396635 TCAACTTTTAAATAGAAAGAAGG + Intergenic
957646884 3:82940671-82940693 GCAACTTTTAACTTATAAGAGGG - Intergenic
957809229 3:85196438-85196460 TCATCTTATAAATTATAACAAGG - Intronic
958203657 3:90358594-90358616 TCACATTAAAAATTAACAGAAGG - Intergenic
959168605 3:102814629-102814651 TAACCTTTTAAATCAAAATGAGG - Intergenic
959363841 3:105431056-105431078 TCTATTTTTAAATTAAAAAATGG - Intronic
960193783 3:114740240-114740262 TCACTATTTAAATAAAATGATGG + Intronic
960445021 3:117737401-117737423 ACATCTTTTAAATCAAAGGATGG - Intergenic
960570131 3:119177661-119177683 TAAACTTTTAAATTAATTGACGG - Intronic
962065200 3:131972438-131972460 TCCCCTTTCAAATAAACAGATGG + Intronic
962484747 3:135831395-135831417 TAACTTTTTAACTTACAAGAAGG - Intergenic
963580518 3:147121156-147121178 TCATTTTGTAAATTAAAGGAAGG - Intergenic
964331228 3:155605519-155605541 TAAAGGTTTAAATTAAAAGAAGG + Intronic
965045043 3:163566946-163566968 TTACTTTTAAAATTAAAATATGG - Intergenic
965243513 3:166233354-166233376 TAACCTTATAAATAAAAAGATGG + Intergenic
965903273 3:173670335-173670357 TCACCTTTTAACTTATAGTAAGG + Intronic
966177614 3:177156027-177156049 TTAGCTTTTAGATTAAAAAATGG - Intronic
966398386 3:179524086-179524108 TCCCCTTCTTAATTAAAATATGG - Intergenic
966455607 3:180112303-180112325 TGACCTTTACAATTAAAAGTTGG - Intergenic
966627668 3:182036192-182036214 TCACCTGTGAAATAAAGAGATGG - Intergenic
967680363 3:192355311-192355333 ATACATTTTAAGTTAAAAGAAGG + Intronic
968022625 3:195407349-195407371 TTATTTTTTAAATTAAAAAAAGG + Intronic
969328241 4:6456537-6456559 TCACCTTTCACATTGAAAGTCGG + Intronic
969945863 4:10782578-10782600 TCACATTTGAAATCAACAGAAGG - Intergenic
970080298 4:12276130-12276152 CCACCTTGTGAATTAAAAGAGGG + Intergenic
970187773 4:13480446-13480468 TTAACTTTTAAAATAAAAAACGG - Intronic
970827568 4:20294801-20294823 TCACTTCTCAATTTAAAAGATGG - Intronic
970953542 4:21784450-21784472 TCACATTTTAAAGAAAAACAAGG + Intronic
973027782 4:45293970-45293992 TTGCCTTTTAAATACAAAGAAGG + Intergenic
973750545 4:54015428-54015450 TCTCCTTTTAAATGAAAATAGGG + Intronic
974592949 4:63978670-63978692 TCACCTATTAAATAAAATGAAGG - Intergenic
975162686 4:71141940-71141962 CCAGCCTTTCAATTAAAAGATGG - Intergenic
975653406 4:76617014-76617036 TCACCTTTCAAATGCAAAGTAGG - Intronic
975780420 4:77833430-77833452 TCACTTTTTAAATTACTAGATGG + Intergenic
975940255 4:79635219-79635241 TCAATTTTTACATTAAAATATGG - Intergenic
976421666 4:84852048-84852070 TTACCTTTTCACTTAAAGGAAGG + Intronic
977229215 4:94431865-94431887 TCACCTTGTAATTTTAAAAAGGG - Intergenic
977391626 4:96416671-96416693 TCACCTTTTATATTATTTGATGG - Intergenic
977689136 4:99884661-99884683 ATAACTTTTAAAATAAAAGATGG + Intronic
977799231 4:101205827-101205849 TCACCTTTTACATGCAAAAATGG - Intronic
978605408 4:110474275-110474297 TGATCTTTTCAATAAAAAGAGGG + Intronic
978742864 4:112157936-112157958 TAAGCTTTTAAATTTAAAGAAGG + Intronic
979067028 4:116150492-116150514 TTACCTTTTAGAATAAATGAGGG - Intergenic
979463430 4:121008763-121008785 TCACCTTATAAATTAATAAGAGG - Intergenic
979801619 4:124916297-124916319 AGACCTGTTAAAATAAAAGAAGG - Intergenic
980009178 4:127577289-127577311 TCATCTATGAAATAAAAAGATGG + Intergenic
980185425 4:129455286-129455308 TCATGTTTTAAATGAAGAGAAGG + Intergenic
980337232 4:131491918-131491940 TCACCTGTTAAACCAAAAGCTGG - Intergenic
980567326 4:134560423-134560445 AGACATTTTAAGTTAAAAGAGGG + Intergenic
980680716 4:136155982-136156004 CCCCCATGTAAATTAAAAGAAGG - Intergenic
980722017 4:136710258-136710280 TCAGCTTTGAAAATAAAATAGGG - Intergenic
980924058 4:139116554-139116576 TCACCCTTTAAACAAAAATATGG + Intronic
981767183 4:148264278-148264300 TTATCTTTGAAACTAAAAGATGG + Intronic
982973902 4:162027867-162027889 TCAATTTTCAAATTAAATGAGGG - Intronic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
983116496 4:163823988-163824010 TCAAGTTTTTAATTAAAAGATGG + Intronic
983908417 4:173208719-173208741 GAACCATTTAAATAAAAAGACGG - Intronic
984260625 4:177440714-177440736 GTACCTTTTAAAATAAAGGAGGG - Intronic
984822830 4:183897969-183897991 TAAGCTTTTCAATTAAAAAAAGG - Intronic
985345882 4:189003574-189003596 TCCCACTTTAAATTAAAAGCTGG + Intergenic
986139395 5:5015936-5015958 TCAACTTATAAAGTAGAAGAAGG + Intergenic
986601312 5:9475830-9475852 TCACGTTTTAAACTAACATATGG + Intronic
987371274 5:17195371-17195393 TCACCTTTGAATTGAAATGATGG - Intronic
987729532 5:21751147-21751169 AAACCTTTTGAATTAGAAGAAGG + Exonic
987993126 5:25241206-25241228 TCATCTTTTAACTTAAATAATGG - Intergenic
988244497 5:28661755-28661777 TTACATTTTAACATAAAAGAAGG - Intergenic
988550572 5:32197347-32197369 TAGGCTTTTAAAATAAAAGAAGG + Intergenic
989969712 5:50508205-50508227 TCAACTTTTATATTAGAAGCAGG - Intergenic
990216998 5:53545259-53545281 TCAGCTTGTAAATTACAAGTGGG - Intergenic
990379944 5:55213322-55213344 TGACCTTTTAATTTTAAAAATGG - Intergenic
991443001 5:66670770-66670792 TCACCTTTTGAGTTACAAAAGGG - Intronic
991629712 5:68644365-68644387 TTTCTTTTTAAAATAAAAGAAGG + Intergenic
992098825 5:73386552-73386574 TTACCTTTAAAATTAAGGGAAGG - Intergenic
992406756 5:76466000-76466022 TCTCCATTTAAAAAAAAAGAAGG - Intronic
992764373 5:79983154-79983176 TCACTTTTTAAAGTTAAATATGG + Exonic
994878673 5:105459032-105459054 TTGCCTTTTAAATTGCAAGAGGG + Intergenic
995577994 5:113561813-113561835 TCACCTTTTAAGTTCTCAGAGGG + Intronic
995792981 5:115913476-115913498 TTACATTTTTATTTAAAAGAGGG - Exonic
995907606 5:117144376-117144398 CCAGCTTGGAAATTAAAAGAAGG + Intergenic
996522804 5:124446163-124446185 GCACAGTTTAAATTAAAAAACGG - Intergenic
996891972 5:128431631-128431653 TCATCTTTTCATTTAAAAGGGGG + Intronic
996972727 5:129392152-129392174 TAATATTTTAAATTCAAAGAAGG + Intergenic
997057064 5:130456861-130456883 TCACATTTAAAATTAAAACAGGG - Intergenic
997915455 5:137920391-137920413 TCATCTTTAAAATTAGAAAAAGG + Intronic
997919273 5:137963064-137963086 TCACCTTTCAAATCAACAAAAGG + Intronic
998422717 5:142002449-142002471 CATCCTTTTAAAGTAAAAGAAGG + Intronic
998660622 5:144233196-144233218 TCAACTGTTAAATAAAAAAAGGG + Intronic
1000620147 5:163475877-163475899 TTAACTTTTAACTTAAAAGAGGG - Intronic
1002772522 6:301906-301928 TTATCTTTAAAATTAAATGAGGG - Intronic
1002954323 6:1847061-1847083 CCCCTTTTTAAAATAAAAGACGG + Intronic
1003283893 6:4717407-4717429 TCAGTTTTTAAAACAAAAGAGGG + Intronic
1003740181 6:8928140-8928162 TGACTTTTTAAAATAAAATAGGG - Intergenic
1003872959 6:10416208-10416230 TCCCCTTTTTAATTAAAGCAGGG + Intronic
1004758278 6:18637705-18637727 TTTCTTTTTAAATTAAAAAATGG - Intergenic
1006479880 6:34283505-34283527 TCCCCTTATAAATTAATAAATGG - Exonic
1008321405 6:50118651-50118673 TCCCCTATTAAAATAACAGAAGG + Intergenic
1008601823 6:53103779-53103801 TCACCTTTTTAATAAAAAAATGG - Intergenic
1009398070 6:63225423-63225445 TCTCATTTAAAATTAAAAAATGG - Intergenic
1009795186 6:68457092-68457114 TCAACTTTTAAAATAGAAAATGG - Intergenic
1010115281 6:72298961-72298983 TCAGCTTTCAACATAAAAGAGGG - Intronic
1010338166 6:74714076-74714098 TCACCTTTAAAAATAAAATAGGG - Intergenic
1010557222 6:77297706-77297728 TAACCATTTAAATTATAAGCTGG - Intergenic
1010694644 6:78955758-78955780 TCAACTTTTACCTTAAAATATGG - Intronic
1011451502 6:87497509-87497531 TCACTTTTCACATAAAAAGAAGG - Intronic
1012097353 6:94978826-94978848 TGACCTTATAAATAAAAACATGG + Intergenic
1012277384 6:97290894-97290916 TCACCTTTTATTTTTACAGATGG + Intergenic
1012580591 6:100865068-100865090 TCACATTTGAAATTAAAAAATGG - Intronic
1012863029 6:104583781-104583803 ACAGCTTTTAAATTAACAGAAGG - Intergenic
1013780296 6:113721075-113721097 TCACTTTTTAAATTAAGACAGGG - Intergenic
1013911742 6:115283552-115283574 TGACATTTTTAATTAAAGGAAGG + Intergenic
1014100243 6:117503748-117503770 TCACCTGGTAAAGAAAAAGAAGG - Exonic
1014260686 6:119213151-119213173 TACCATTTTAAATTATAAGATGG - Intronic
1014633384 6:123814770-123814792 TGAAATATTAAATTAAAAGATGG - Intronic
1015263435 6:131264589-131264611 TAACCTTCTAACTTGAAAGAGGG + Intronic
1016224193 6:141714908-141714930 TCACCTTTTAAAACAGAATATGG + Intergenic
1016480374 6:144474914-144474936 TCATTTTTTAAATTAAGAGAGGG + Intronic
1016565482 6:145448178-145448200 GCACTTTTTAAATTAAAAAATGG - Intergenic
1017184103 6:151583423-151583445 TCTCATTTTAACTCAAAAGATGG - Intronic
1018299977 6:162390972-162390994 TCAGCATCTGAATTAAAAGAAGG - Intronic
1018364598 6:163106110-163106132 TCATCTGTTAAATTAGAGGAAGG - Intronic
1019118942 6:169787961-169787983 TCCCTTTTTAAATTAAGTGATGG + Intergenic
1020400042 7:7766105-7766127 TCACTGTTAACATTAAAAGAAGG - Intronic
1020415191 7:7937554-7937576 TGCCCTTTTCAATTAAAGGAAGG + Intronic
1020867014 7:13578094-13578116 TCACTTTTTAAAGAAAAATATGG - Intergenic
1021239495 7:18182890-18182912 TCACCTTATCAATTAAAAAACGG + Intronic
1022016949 7:26358366-26358388 GCACATTCTAAATTATAAGAGGG - Intronic
1023453151 7:40309599-40309621 TCAGCTTTTAAATAAAAGTATGG + Intronic
1023781230 7:43657416-43657438 TTAAGTTTTAAATTAGAAGATGG + Intronic
1025523069 7:61765604-61765626 TGAGCTGTTAAATCAAAAGAAGG + Intergenic
1025546820 7:62184633-62184655 TGAGCTGTTAAATCAAAAGAAGG + Intergenic
1026234868 7:68518589-68518611 TCAGCTTTGAAATTAGAAGGGGG + Intergenic
1026264776 7:68786655-68786677 TCATAGATTAAATTAAAAGATGG + Intergenic
1026917842 7:74132867-74132889 TCTCTTTTTAAAAAAAAAGAAGG - Intergenic
1027732265 7:81889518-81889540 TCACTTTTGAGATTAAAAAAAGG + Intergenic
1028057579 7:86266209-86266231 TGACCTTTTATATTCAAAGTGGG - Intergenic
1028090089 7:86689689-86689711 GTAACTTTTGAATTAAAAGAAGG + Intronic
1028166051 7:87539380-87539402 CCACCATTTAAATAAAAGGAGGG + Intronic
1028950016 7:96624091-96624113 TTACCTTATATGTTAAAAGATGG - Intronic
1030394974 7:108974603-108974625 TCACCTTTTAAAATATAAACTGG - Intergenic
1030490375 7:110225251-110225273 TAATCCTTGAAATTAAAAGATGG + Intergenic
1030783844 7:113635910-113635932 TTACATTTTAATTTAAAAGTAGG + Intergenic
1030872396 7:114773293-114773315 TCATCTTTTAAATAAAGAAAAGG - Intergenic
1031024598 7:116666697-116666719 TCAAAGTTTAAATTAACAGATGG + Intergenic
1031108110 7:117570544-117570566 TCACATTTTAAAGTAAAAAGAGG + Intronic
1031327333 7:120418080-120418102 TGACCTTTTATATTAAATGAAGG - Intronic
1031336937 7:120546434-120546456 TAACCTTGTGAATTAAGAGAAGG + Intronic
1031459422 7:122027667-122027689 TCAATTTTTAAAATTAAAGATGG + Intronic
1031490851 7:122385963-122385985 TCAGATTTCAATTTAAAAGAAGG + Intronic
1031555696 7:123173286-123173308 TTACCCTTGAAATTAAAAGTAGG + Intronic
1032816258 7:135477535-135477557 TTTCCTTTTCAATTAAAAGAGGG - Intronic
1033022375 7:137739356-137739378 TCATCTCTAAAATGAAAAGACGG + Intronic
1033801000 7:144902195-144902217 TTACCTCTTAAATTAGAAGGTGG + Intergenic
1033907929 7:146229189-146229211 TCCCCTTATAAATAAAAAGTTGG + Intronic
1034079640 7:148264526-148264548 TCAACTTTTTAAATAAAAAAGGG - Intronic
1034215580 7:149403207-149403229 TCACCTTTTAAAATGTAAAACGG + Intergenic
1034392111 7:150794751-150794773 ACACCTATGAAATGAAAAGAGGG - Intronic
1034519813 7:151611121-151611143 TCTGCTTTTAAGTCAAAAGAAGG + Intronic
1035419828 7:158717943-158717965 TGACCTTTAAAAAAAAAAGAAGG - Intergenic
1036185901 8:6622181-6622203 TCACTTTGTCAAATAAAAGATGG - Intronic
1039731542 8:40284291-40284313 TCTATTTTTAAATAAAAAGATGG + Intergenic
1039822869 8:41149116-41149138 TTACCATTTAAATGAAAAAACGG - Intergenic
1040814029 8:51487751-51487773 TCCTCTTTTCTATTAAAAGAAGG - Intronic
1041096411 8:54354795-54354817 TCACCTCCTAACTTAAAAGGTGG + Intergenic
1041806933 8:61861752-61861774 TCACCTTTTTACTTGAAGGAAGG + Intergenic
1042004207 8:64163210-64163232 TCATCTTTTAATTTAAAAGTAGG + Intergenic
1042233956 8:66589211-66589233 TTTCCTGTTAAATTAAAAAAGGG + Intronic
1042583889 8:70313818-70313840 TCACCTTCTGAATTATAAAATGG - Intronic
1042598941 8:70478899-70478921 TCACCCTCTAACTTAAAAGATGG + Intergenic
1042635717 8:70871763-70871785 TCTCATTTTAAATCAAAAGCTGG + Intergenic
1042671776 8:71271958-71271980 TCCCCTTGTGAATTAAAACAAGG - Intronic
1043196096 8:77293508-77293530 TCACCTATTCACTTAAAGGATGG - Intergenic
1043238929 8:77906306-77906328 TCTCCTTTGAAAATAAAAGTGGG + Intergenic
1043290016 8:78587081-78587103 TCATCTTTAAAATCAAAAAAAGG - Intronic
1043699985 8:83273923-83273945 ACACATTATAAATTAAAAGATGG + Intergenic
1044639549 8:94364214-94364236 TCAGATTTTGAGTTAAAAGAGGG + Intergenic
1045465596 8:102466748-102466770 TCTCATTTTAAATCAAAAGCTGG - Intergenic
1045639244 8:104229434-104229456 TCACTCTTTAAATGAAAACAGGG + Intronic
1047898207 8:129390437-129390459 TCTCATTTTAAATTAATAAATGG + Intergenic
1048765741 8:137842591-137842613 TTACCTGTAAAATTAAAAAATGG - Intergenic
1048893280 8:138966559-138966581 TCACTTTTTAAACTCAAATATGG + Intergenic
1050722350 9:8605032-8605054 TCAACTAATAGATTAAAAGATGG - Intronic
1050955350 9:11650790-11650812 TCATCTTTTGATTCAAAAGAGGG + Intergenic
1051117985 9:13719222-13719244 CCAACTTTTAATTTCAAAGAAGG + Intergenic
1051203142 9:14652901-14652923 TCAGCTTTGGAATTTAAAGATGG + Intronic
1051242684 9:15076682-15076704 TCACATTTTAGTTTAAGAGAGGG + Intergenic
1051263348 9:15287614-15287636 TTACATTTTAACTTAAATGAAGG - Intronic
1051985956 9:23087517-23087539 TCAGTTTTTAAATTAACATAGGG - Intergenic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1052725233 9:32221234-32221256 TCATATTTTAATCTAAAAGATGG - Intergenic
1053065828 9:35068351-35068373 TCACCTTTTGAACTAGAAGGAGG + Exonic
1055601196 9:77920698-77920720 TCACCCTTGAAAATAAAAGCAGG + Intronic
1055618511 9:78098617-78098639 TTACCTTTGAAATTTAAAGATGG + Intergenic
1056044220 9:82700154-82700176 TCCACTTTAAAATAAAAAGAGGG - Intergenic
1056226340 9:84499110-84499132 TCTCCTGTTGAATTAAAACAGGG + Intergenic
1056519008 9:87382854-87382876 TCACCTTTTCACTTAAAGGAAGG + Intergenic
1057442698 9:95093431-95093453 TCTCCTTTTAAAGTTACAGATGG + Intergenic
1057508130 9:95653389-95653411 TCACTTTTTAAATTCAAATATGG - Intergenic
1057666123 9:97046821-97046843 TCCCCTTATAAATCAAAACAGGG + Intergenic
1059046797 9:110877927-110877949 ACACCTTTTAAATTTTAACATGG - Intronic
1059386019 9:113965151-113965173 TTAGCATTTAAATTAAAAAAGGG + Intronic
1060333817 9:122702965-122702987 TAAAATTTTAAATTAAATGATGG + Intergenic
1062165059 9:135103518-135103540 TCACTTTTGCATTTAAAAGAGGG + Intronic
1203428815 Un_GL000195v1:69587-69609 TCATCTTTTAACTTAACAGGTGG - Intergenic
1185840901 X:3390420-3390442 TCACTTTTTAAATCGTAAGAGGG - Intergenic
1185841043 X:3391461-3391483 TCACTTTTTAAATGGCAAGAGGG + Intergenic
1185940357 X:4311848-4311870 TCCCTTTTTAAATGAAAAGTTGG - Intergenic
1187585609 X:20658431-20658453 TGACTTTTTATTTTAAAAGAAGG + Intergenic
1188131681 X:26442376-26442398 TTTCCTTTTAAAATAGAAGAAGG - Intergenic
1190121121 X:47659816-47659838 TTACCATTTAAATAAAAACATGG - Intergenic
1190584604 X:51926567-51926589 TCACTTTTGAAAGTAAATGAAGG + Intergenic
1191587401 X:62843846-62843868 TAACCTTTTATATTAGAATAGGG - Intergenic
1192019592 X:67372130-67372152 TCAGCATTTAAAATAAAGGATGG + Intergenic
1192678479 X:73225670-73225692 TCACCTTGTAAAATTTAAGATGG - Intergenic
1192703703 X:73504920-73504942 TCACCATAAAAATTAAATGAAGG + Intergenic
1193360150 X:80571806-80571828 ACACCTTGTAATTTAAAACAGGG + Intergenic
1194540695 X:95167876-95167898 CAACCTTTTCAGTTAAAAGACGG - Intergenic
1195137915 X:101929552-101929574 TCACCTTTTCACTTAACAAATGG - Intronic
1195584001 X:106542377-106542399 TCTCCTTTTAACTTAAAATGTGG - Intergenic
1196170756 X:112586552-112586574 TAAAATTTTAAATTAAACGATGG + Intergenic
1196703219 X:118694162-118694184 TTACCTTTTAAATGAAAAAGTGG - Intergenic
1197080236 X:122404086-122404108 ACAGCTTTTAAATTAAAAGATGG + Intergenic
1197522600 X:127519022-127519044 AAACATTCTAAATTAAAAGATGG - Intergenic
1197835688 X:130691316-130691338 TCACATTTTAAATGGAAGGAAGG - Intronic
1198007164 X:132506958-132506980 TTTCCTTATAGATTAAAAGATGG - Intergenic
1198249210 X:134863319-134863341 TAACCTTAGAAATTAAAAGATGG - Intergenic
1198597662 X:138254556-138254578 TCACCTTTTCACTTAAAGGGAGG + Intergenic
1199029855 X:142984722-142984744 TGACCTTTTAAATTCAAAGAAGG - Intergenic
1199479959 X:148287637-148287659 TCAGATGTTAAATTAAATGATGG - Intergenic
1199652926 X:149965553-149965575 TCTCATTATAAAATAAAAGAAGG - Intergenic
1201010178 Y:9544153-9544175 TCAACTTTTATATTAATAGTAGG + Intergenic
1201608186 Y:15810912-15810934 TAACCTTTTAAACAAAATGAAGG - Intergenic