ID: 951881178

View in Genome Browser
Species Human (GRCh38)
Location 3:27483380-27483402
Sequence CAGGCCAAGTAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 453}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951881178_951881186 -2 Left 951881178 3:27483380-27483402 CCCTCCTCCTTCTACTTGGCCTG 0: 1
1: 0
2: 7
3: 39
4: 453
Right 951881186 3:27483401-27483423 TGCGGCAGGAGGATACTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 114
951881178_951881187 -1 Left 951881178 3:27483380-27483402 CCCTCCTCCTTCTACTTGGCCTG 0: 1
1: 0
2: 7
3: 39
4: 453
Right 951881187 3:27483402-27483424 GCGGCAGGAGGATACTCCCCGGG 0: 1
1: 0
2: 2
3: 8
4: 114
951881178_951881192 18 Left 951881178 3:27483380-27483402 CCCTCCTCCTTCTACTTGGCCTG 0: 1
1: 0
2: 7
3: 39
4: 453
Right 951881192 3:27483421-27483443 CGGGTCCCAGCCAGTGGAGAAGG 0: 1
1: 0
2: 3
3: 20
4: 199
951881178_951881193 21 Left 951881178 3:27483380-27483402 CCCTCCTCCTTCTACTTGGCCTG 0: 1
1: 0
2: 7
3: 39
4: 453
Right 951881193 3:27483424-27483446 GTCCCAGCCAGTGGAGAAGGCGG 0: 1
1: 1
2: 3
3: 47
4: 390
951881178_951881188 12 Left 951881178 3:27483380-27483402 CCCTCCTCCTTCTACTTGGCCTG 0: 1
1: 0
2: 7
3: 39
4: 453
Right 951881188 3:27483415-27483437 ACTCCCCGGGTCCCAGCCAGTGG 0: 1
1: 0
2: 2
3: 17
4: 161
951881178_951881196 27 Left 951881178 3:27483380-27483402 CCCTCCTCCTTCTACTTGGCCTG 0: 1
1: 0
2: 7
3: 39
4: 453
Right 951881196 3:27483430-27483452 GCCAGTGGAGAAGGCGGACCCGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951881178 Original CRISPR CAGGCCAAGTAGAAGGAGGA GGG (reversed) Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901239746 1:7686073-7686095 CAGCCCAGGTGGAAGGAGGTGGG - Intronic
901705630 1:11071036-11071058 TAGGCCAAGTCGGAGGGGGATGG - Intronic
902811857 1:18892539-18892561 CATCCCAGGTAGAAGGAGGCGGG + Intronic
903590320 1:24450744-24450766 CAGGCCACGGGGAAGGAAGATGG - Intronic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904585767 1:31579739-31579761 CATTCCCAGTAGGAGGAGGAAGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906561386 1:46760401-46760423 CAAGCCCAGGAGAAGTAGGAAGG - Intronic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907971810 1:59390462-59390484 CAGTCCATGTAGCAGGAAGAAGG + Intronic
908003723 1:59707382-59707404 GAGGCCAAGCTGTAGGAGGAGGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
910252795 1:85215669-85215691 AGGGCCAAGTAGCAGAAGGATGG - Intergenic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
912720980 1:112019764-112019786 CAGGACAAGTTAAAGGGGGAGGG + Intergenic
914196779 1:145451871-145451893 CAGGCAAAGTGGGAGGAGGAGGG + Intergenic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915547512 1:156609748-156609770 CAGGCCTACTTGAGGGAGGAGGG + Intergenic
915566639 1:156717672-156717694 CAGGCCAAATAGCTGGAGGTTGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916249958 1:162728369-162728391 CAGGCCAGGTAAAAAGAGGAAGG + Intronic
916253958 1:162767166-162767188 CAGGTCAAGTAAAAGTATGAGGG - Intronic
916335528 1:163666792-163666814 GCAGCCAGGTAGAAGGAGGAAGG - Intergenic
916454969 1:164961701-164961723 CAGGCCAGGTGTGAGGAGGAGGG - Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
917927875 1:179803979-179804001 CAGGCCAGGCGGCAGGAGGAGGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918511340 1:185317068-185317090 GCGGTCAAGTAGAAGGACGAGGG + Exonic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920508415 1:206533248-206533270 CAGGCCTGGTAGAAGTAGGCAGG + Intronic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
922061254 1:222094564-222094586 GAAGCCATGGAGAAGGAGGATGG - Intergenic
922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG + Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923192283 1:231630857-231630879 CACACCAAGTAGAAGCAGGAAGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1064016852 10:11779478-11779500 CAGCCCTGGTAGGAGGAGGAGGG + Intergenic
1064535043 10:16349818-16349840 GAGGCGAAGTAGAACCAGGAAGG + Intergenic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1065861994 10:29879583-29879605 CAGGCCTAGTAGAAGGAAGCAGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068262610 10:54601972-54601994 GAGGCCAACCAGAAGGTGGAGGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068719419 10:60227509-60227531 CAGGCAAAGGAGAAAGAGAATGG - Intronic
1069305238 10:66961363-66961385 CAGTTCAAGTAAGAGGAGGATGG - Intronic
1069602503 10:69717035-69717057 CAGGCCGAATGGCAGGAGGAGGG - Intergenic
1069623978 10:69855762-69855784 CATGCCCAGTAGAAGGGGGGAGG + Intronic
1069854937 10:71434908-71434930 CATGCCAAGAAGAAGGCAGATGG - Intronic
1069855626 10:71439484-71439506 TAGGCCCAGTAGATGGAGGCAGG - Intronic
1069963159 10:72090656-72090678 GAGGCCAAGAGGCAGGAGGATGG + Intergenic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070165382 10:73893675-73893697 CAGGGAAAGTATAAGGAGCAAGG - Intergenic
1070316783 10:75321173-75321195 CAATCCAAGTAGAAGGTGAAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072539378 10:96386591-96386613 CAAGCCAGGTAGAAATAGGATGG + Intronic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1073290873 10:102412647-102412669 CAGGCCCAGAAGATGGAGAAGGG + Intronic
1073451692 10:103613395-103613417 CAGGCAAAGAAAAAGGAGCATGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073498289 10:103913899-103913921 CAGGCCCCCAAGAAGGAGGAGGG + Intronic
1074112276 10:110431089-110431111 CAGGCCCAGAAGGAGGAGCAGGG - Intergenic
1074278134 10:112024200-112024222 GTGGCCAAGAAGATGGAGGAAGG - Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1078134138 11:8638405-8638427 CATGCAGAGTGGAAGGAGGAAGG - Intronic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1081548722 11:44092762-44092784 TAGGCCAAGGAGGAGAAGGAAGG + Intergenic
1081588304 11:44402848-44402870 GAGGCCAAGTAGATGGGGGTGGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1082162419 11:48900303-48900325 CAGGCCAAGGTGCAGGAGAAGGG - Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1083411917 11:62499733-62499755 GAGGCCACGTAGAATGATGATGG + Intronic
1083815095 11:65128222-65128244 TAGGCCAAGTGGAAAGAGGCTGG - Exonic
1084266897 11:68009826-68009848 CAGGCAAGGTGGTAGGAGGAGGG + Intronic
1084586476 11:70065575-70065597 CAGGCCAACTAGAGGGACGACGG - Intergenic
1084586492 11:70065629-70065651 CAGGCCAACTAGGGGGACGACGG - Intergenic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1088224003 11:107599096-107599118 GAGGACAAGTAGGAGGAGGTGGG + Intronic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1089526487 11:119100643-119100665 CAGGCCAAGTATCGGGCGGAAGG + Exonic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089767917 11:120781964-120781986 CATGCCAAGTTGGAGGAGAAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090624231 11:128591985-128592007 CAGGCCCAGTGGAACCAGGATGG - Intergenic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092951132 12:13504602-13504624 CAGGCCCAGTACCAGGAGAAGGG + Intergenic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098051561 12:66459302-66459324 CACCCAAAGTAGAATGAGGATGG - Intronic
1098270187 12:68762438-68762460 CAGGCCAAGTTCAAGGAGACTGG + Intronic
1098306398 12:69107017-69107039 CATGGCAAGAAGAAGCAGGAAGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1100818521 12:98408976-98408998 GAGGCCCTGTAGTAGGAGGAAGG + Intergenic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103830531 12:123775626-123775648 TTGGCCCAGTAGCAGGAGGATGG + Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104248062 12:127061895-127061917 CAGGCCATGTAGATACAGGATGG + Intergenic
1105660417 13:22487999-22488021 TGGGCCAAATAGGAGGAGGAGGG + Intergenic
1106021950 13:25924107-25924129 CAGACAACGTGGAAGGAGGAGGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113088809 13:106595883-106595905 CAGGCCCAGTGGAAGGAGTGAGG + Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114769131 14:25408693-25408715 GAGACCAATTAGAAGGATGATGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117067484 14:52024874-52024896 CAGGACAAGTAGAAGAAAAAAGG + Intronic
1117185015 14:53231391-53231413 GAGGGCAAGTAGAAGCAGGGAGG + Intergenic
1117401098 14:55358935-55358957 CAGGTCTGGTGGAAGGAGGAGGG + Intronic
1117484616 14:56181716-56181738 CAGGCTAAGTCAAATGAGGATGG + Intronic
1118049702 14:62013628-62013650 CAGGTAAAGTTGAAGGAGGTGGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119090355 14:71775103-71775125 CAGGACAACTCGAAGCAGGAAGG - Intergenic
1119873146 14:78033946-78033968 GAGGCCAATTAGGAGGAGGTGGG - Intergenic
1121460871 14:94076925-94076947 TAGGCTGAGTAGAAAGAGGAGGG - Intronic
1121757427 14:96414712-96414734 CAGGCCAAGAAGACGGATGGAGG + Intronic
1122635571 14:103128117-103128139 CAGGCCAGGAGGCAGGAGGAGGG + Intronic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1126328978 15:47511573-47511595 CAGGCCAACTCTATGGAGGAGGG - Intronic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1127487166 15:59429944-59429966 CAGGCCAGGTAGTAGGACTAGGG + Intronic
1127966799 15:63928779-63928801 CAGGCAAAGAGGAAGGAGAAAGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1130024508 15:80259951-80259973 GAGCCCAAGAAGAAGGAAGAAGG - Intergenic
1130094111 15:80843601-80843623 CAGGCCAGGTGGCAGAAGGAAGG + Intronic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132543147 16:520828-520850 GAGGTCAAGTAGAGGCAGGAAGG + Exonic
1132701384 16:1223591-1223613 CACCCTAAGTCGAAGGAGGAAGG + Exonic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133621642 16:7532205-7532227 CAAGCCAATTAGAGGGAAGAGGG - Intronic
1133805326 16:9122338-9122360 TAGCCCAAGTAGAGGGAGTATGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1136283872 16:29230190-29230212 CAGGCCAGGTGCAGGGAGGACGG + Intergenic
1136381475 16:29898066-29898088 CAGGCCCAGCTGATGGAGGAGGG - Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137610064 16:49811984-49812006 CAGGCCTAGGGGCAGGAGGAAGG - Intronic
1138420072 16:56893114-56893136 CAGGCCAGGAAGGAGAAGGAAGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139100272 16:63758134-63758156 CTGGCCATGTAGAATGAGGTTGG - Intergenic
1139150090 16:64371489-64371511 AAGGTCACGTAGAAGGAGGGAGG + Intergenic
1140679420 16:77369730-77369752 CAGGCCATGTAGAATGAGTTTGG - Intronic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142211890 16:88812338-88812360 CGGTCCAAGTAGCAGGAGGGCGG + Intergenic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143236525 17:5406353-5406375 GAGGCAAAGTACAAGGTGGAAGG + Intronic
1145196195 17:20896583-20896605 CAGGCCAAGTAGGAGCTGGGCGG - Intergenic
1145891171 17:28416841-28416863 CAGCCCAAGGAGAAGGATAAAGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146559403 17:33855114-33855136 CAGGCCAAGTTGCTGGGGGAAGG + Intronic
1147136169 17:38435284-38435306 GATGCCAAGTGGGAGGAGGAAGG + Intronic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148607869 17:48943956-48943978 CAGGCCAAGTATAAGGAGCGAGG - Exonic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1152458416 17:80428951-80428973 CAGGCTAAGTGGACTGAGGAAGG - Intronic
1152596643 17:81240984-81241006 CAGGCCAAGAAGACGCTGGAGGG + Exonic
1153915212 18:9738788-9738810 GAGGCCTAGCACAAGGAGGAAGG - Intronic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156953317 18:42931555-42931577 CAAGTCAAATAGAAAGAGGAAGG - Intronic
1157380076 18:47206331-47206353 CAGGCAAAGTACAGAGAGGAAGG + Intergenic
1157572837 18:48724321-48724343 CAGGCCATCTACAAGGAGCAGGG - Intronic
1157579779 18:48766922-48766944 CAGGCCAAGGAAAAGGAAAATGG - Intronic
1157703807 18:49783800-49783822 CTGGCCAAGTAGAGTAAGGATGG + Exonic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161715492 19:5873948-5873970 CAGACCAGGTAGCAGCAGGAAGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1163672366 19:18636681-18636703 CAGGACAAGTAGGCGCAGGATGG - Intergenic
1163904782 19:20142939-20142961 GAGGCCTAGTAGAGGGTGGAGGG + Intergenic
1164095322 19:22004748-22004770 GAGGCCTAGTAGAGGGTGGAGGG + Intronic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166597388 19:44061913-44061935 CAGGCCAAGTAAAGATAGGATGG - Intronic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
925919994 2:8631879-8631901 CAGGTCAGCTAGAAGGAGGGGGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
927278196 2:21279601-21279623 CAGGCAGGGTAAAAGGAGGAGGG - Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928924673 2:36565573-36565595 GAGGTCAGGTAGAAGGAGGAGGG - Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931897083 2:66744276-66744298 GAGGCCATGTAGAGGGAGAAGGG + Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
933985371 2:87586693-87586715 CAGACCAGGTTGAAGGAGAAGGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935897721 2:107755637-107755659 CTGGCCAAGAAGATGGAAGAAGG - Intergenic
936308470 2:111364116-111364138 CAGACCAGGTTGAAGGAGAAGGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
937645104 2:124257821-124257843 CAGACCAAGTAGAGAGATGAAGG - Intronic
937982651 2:127624401-127624423 GAGGCCAGGTAGAAGGTGGGGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938452196 2:131431359-131431381 CAGGCCAAGTAGATGGAGCTTGG + Intergenic
938576015 2:132605529-132605551 CAGGCCAGCGAGAAGCAGGAAGG - Intronic
941005880 2:160246443-160246465 CAAGTCAAGTAGAACGTGGAAGG - Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
943965711 2:194328819-194328841 CAGGCCAAGTGGGAGGAACAAGG + Intergenic
944467018 2:200012112-200012134 CAGGCCAAAAAGAAGGTGTATGG + Intergenic
944486811 2:200215461-200215483 CAAGCCAAATAGAGGGAGGAAGG - Intergenic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
948062512 2:235052120-235052142 CAAGCCAAGGAAAAGAAGGAGGG - Intronic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170757482 20:19217219-19217241 CAGCCCACGTTGAAGGAGAAGGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1172008844 20:31834601-31834623 CAGGCCCAGGAGAATTAGGAAGG + Exonic
1172953946 20:38742088-38742110 CAGGTTAAGTAGATGGAGCAGGG - Intergenic
1174293389 20:49525157-49525179 CAGGCCAAGTAAAAGAGAGACGG + Intronic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175703789 20:61160589-61160611 CAGGCCAAGATGAATCAGGAGGG - Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1176885170 21:14246554-14246576 CAGGCCAAGTTGTATGAGGAGGG - Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179191388 21:39125161-39125183 CAGGACAAGTGGGAGGAGGGAGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1181827674 22:25531619-25531641 GAGGCCAAGTAGAAAGGAGAGGG + Intergenic
1181850072 22:25743583-25743605 AAGGCCAAGTGGGTGGAGGAGGG + Intronic
1182227282 22:28808736-28808758 CAGGACAATTAGAAGTAGGTGGG + Intergenic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1183350275 22:37331038-37331060 CAGGCCAGGGAGGAGGGGGAAGG - Intergenic
1183604197 22:38859284-38859306 CAAGCCAAGGAGTAGGGGGATGG - Intergenic
1184024143 22:41841479-41841501 GAGGCCAAATAGACAGAGGAGGG - Intronic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
949874700 3:8618580-8618602 CAGGCCTAGTTGAGGGAGGCTGG - Intergenic
950005815 3:9690259-9690281 CAGGCCCAGTATTTGGAGGATGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950447473 3:13046650-13046672 CGGGCCATGGAGAGGGAGGAGGG - Intronic
951766562 3:26205897-26205919 AAAGCCAACTAGAAGGTGGAGGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
953018029 3:39097071-39097093 CAGGCCAACTATATGGAGGGAGG - Exonic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954569722 3:51630469-51630491 CATCCCAAATTGAAGGAGGAAGG - Intronic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
954928292 3:54256968-54256990 CAGTCCAAGTGGATGAAGGAAGG - Intronic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
955719972 3:61870000-61870022 GAGGACAAGTCGAAGGGGGAGGG - Intronic
955815974 3:62843687-62843709 CTAGCCAGCTAGAAGGAGGAAGG + Intronic
956007675 3:64798140-64798162 CAGACCAAGTAGAAGGACCCAGG - Intergenic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956587879 3:70883459-70883481 CAAGCCAAGAAAAAGCAGGAAGG + Intergenic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
957154378 3:76528942-76528964 TAGGCCAAGTAGAAAGAGGTGGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
959189056 3:103086346-103086368 AAAGCCAAATAGAAGGAAGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959296816 3:104545819-104545841 CAGGACAATTAGAAGCAGGGTGG - Intergenic
959365915 3:105457390-105457412 TGGGCCTATTAGAAGGAGGAGGG + Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
965080205 3:164023704-164023726 CAGGCCAAGGAGCTGCAGGAGGG + Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
966744160 3:183259835-183259857 GAGACCAAGAAGAAGAAGGAGGG + Intronic
968199534 3:196740208-196740230 CAGGCCACGGAGAAGGAAGGAGG - Intronic
969461308 4:7330562-7330584 CATGCCAAGCAGAAGGAGCCAGG - Intronic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970554876 4:17220978-17221000 CAGGGCAAGTGGAGGGAGAAAGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971286461 4:25294763-25294785 CAGCCCAAGTAGAAGGGGAGTGG - Intergenic
971851579 4:31991825-31991847 CAGGGCAACTCGAAGGAGGGTGG + Intergenic
972742138 4:41897372-41897394 TATGCAAAGTAGATGGAGGATGG - Intergenic
972826142 4:42761361-42761383 TAGGCAAAATAGAAGCAGGAAGG - Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975695416 4:77008074-77008096 CAGGCTAGCTAGAAGGAGGCAGG + Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
979969054 4:127112167-127112189 CAGGCAAAGTAGCAGAAGCAGGG + Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985828098 5:2207649-2207671 CACGCAAAGTAGAGTGAGGAAGG + Intergenic
986289048 5:6383982-6384004 CAGGGCAACTAGAAGCAGGGAGG + Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
990039630 5:51363523-51363545 CAGACCAAGTCGGAGTAGGATGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992384828 5:76274642-76274664 AAGGCCAAGTAGTAGGTGGAGGG - Intronic
993879324 5:93344368-93344390 CATGCCAAGAAGAAGGGTGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994457571 5:100031522-100031544 CAGGCCAAATAGAATGAGTTTGG - Intergenic
994665260 5:102697173-102697195 CAGGCCAAGGAGCACGAAGAAGG - Intergenic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998385387 5:141754378-141754400 CAGGTGAAGTAGAAGTAGGGCGG + Intergenic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999196345 5:149784126-149784148 CAACCCAAGTAGAAGAAAGAAGG - Intronic
999249161 5:150171725-150171747 TAGGCAAAGTAGCAGGAGAATGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999592472 5:153163503-153163525 CAGGCCACATATAAGGAGGCAGG - Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001491219 5:172156769-172156791 CAGGCCAAGAATAAGGAGACGGG - Exonic
1001787231 5:174424339-174424361 CAGGCCCAGAAAGAGGAGGAGGG - Intergenic
1002065678 5:176650556-176650578 CAGGCCAAGTGGGAGGAGGCAGG + Intronic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1004313272 6:14564582-14564604 GAGTCAAAGTAAAAGGAGGATGG + Intergenic
1004620219 6:17324987-17325009 CAGGCCAAGGAGCTGCAGGAAGG + Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1005766920 6:29020902-29020924 CAGGCCAGGTAGATGTGGGATGG - Intergenic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006359375 6:33578911-33578933 CAGGCCTAGCGGAAGGAGGGTGG - Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007514457 6:42400339-42400361 CATGCCAAGAAGGAGGAGTAAGG + Intronic
1007731430 6:43949997-43950019 TTGGCCAAATAGAAGGAGGTGGG - Intergenic
1008075438 6:47140549-47140571 AAGGCCATGTAGAAGGAAGAAGG + Intergenic
1008291713 6:49723811-49723833 CAGGGCAACTCGAAGCAGGAGGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010880082 6:81156539-81156561 CAGGCCAATAACAAGTAGGAAGG + Intergenic
1011008991 6:82682446-82682468 CAGACCAAGTAGGAGAAGGGTGG + Intergenic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012931343 6:105320525-105320547 CCAGCCAAGGAGAAGGAGAAGGG - Intronic
1013180312 6:107711848-107711870 CAGGCACATTAAAAGGAGGAAGG - Intronic
1013205032 6:107936901-107936923 GAGGTCTAGTAGAGGGAGGAAGG - Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1015242106 6:131036183-131036205 TAGGCAAAGTGAAAGGAGGAAGG + Intronic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016865377 6:148760939-148760961 CGGGCCATGTAGACAGAGGAAGG - Intronic
1017873354 6:158504008-158504030 CGGGCCAGTGAGAAGGAGGACGG + Exonic
1018454193 6:163937611-163937633 CAGGACAACTAGAAGTAGGGAGG + Intergenic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021299165 7:18950223-18950245 CAGGGCAAGTAGAGGCAGAATGG - Intronic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1022008994 7:26292418-26292440 CAGGCCGGGTAGAAGGGGGTGGG + Intronic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022317345 7:29257690-29257712 CAGGCCGAGTAGCAGGAGGAAGG - Intronic
1023225066 7:37960605-37960627 CAGGCCAAGTAGATGGAGTTTGG + Intronic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1023953287 7:44865103-44865125 CAGGCAAAGTAGGACCAGGAAGG + Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025815627 7:64908402-64908424 GAGGCCAAGTTGAGGGTGGAGGG - Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1027995888 7:85424546-85424568 CAGGCCGAGTGGATGGTGGAAGG + Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028715645 7:93964275-93964297 CAGGCACTGTAGAAGGGGGAAGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029466394 7:100727884-100727906 TAGGCCCAGCAGAAGCAGGAGGG + Intergenic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030616858 7:111746295-111746317 CAGGCAAAATAGAAGGGGGTTGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032296017 7:130639024-130639046 GAGGTCAAGTTGAAGCAGGATGG - Intronic
1032361267 7:131257689-131257711 GAGGCCACCTAAAAGGAGGAAGG + Intronic
1032431041 7:131861785-131861807 CAGGGCTACTAGAAGCAGGAAGG - Intergenic
1032620783 7:133529194-133529216 AAGGCAAAGAAGAAGGAGAAAGG - Intronic
1032744105 7:134768513-134768535 CAGCCCAACTAGCAGGAGAATGG - Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1037468228 8:19181943-19181965 CAAGGCAAGAAGAAGAAGGATGG + Intergenic
1038699603 8:29837233-29837255 GAAGCCAAGCAGAATGAGGAAGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1042746070 8:72107389-72107411 GAGGCCAATTACAATGAGGAAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043401096 8:79885071-79885093 CAGGCTAAGTGGGAGGGGGAAGG + Intergenic
1043703535 8:83321616-83321638 GAGGGCGAGTAGAAGCAGGATGG + Intergenic
1044628352 8:94256206-94256228 CAGGCCAAGGAGCAGGTGGGAGG - Intronic
1044964697 8:97563589-97563611 CAGGCCAAGGAGTAGGATCAGGG - Intergenic
1044991335 8:97798826-97798848 CAGGGCAAGTACAAAGAGAAGGG + Intronic
1045542932 8:103103548-103103570 CATGCCAGGTAAGAGGAGGAAGG - Intergenic
1045894049 8:107192985-107193007 CAGGCCAAGTACAAAGAGAGTGG + Intergenic
1046784839 8:118254753-118254775 CAGGCCAAGGAGATCAAGGAGGG - Intronic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1049828569 8:144685631-144685653 CGGGCCAAGAAGATGGCGGAGGG - Intergenic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1050251672 9:3750931-3750953 CAGGTCAAGTAAAAGGAAGGGGG + Intergenic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1056691327 9:88811004-88811026 AAGGCCACGTATAAGGAGGAGGG - Intergenic
1056778652 9:89532971-89532993 CAAGGCAGGTGGAAGGAGGATGG + Intergenic
1057244184 9:93440368-93440390 CAGGCAAATTGGAAGAAGGAGGG + Intergenic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058618790 9:106862525-106862547 GAGGCAAAGGAGAAGGAGAAGGG - Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059723384 9:116983373-116983395 CATGACTAGTACAAGGAGGAAGG + Intronic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061927786 9:133814553-133814575 CAGGCCAGGTGGAAGGAGGGGGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062697951 9:137884963-137884985 CAGGCAAAGTGGGAGGAGGGGGG - Intronic
1187467552 X:19540569-19540591 CAAGCCACGTAGAGGGAGGCAGG + Intronic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1194961247 X:100238329-100238351 CAGGCTAAGTACAAGAAGCATGG + Intergenic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1195923093 X:110002356-110002378 CAGGCCAGGGAGGAGGCGGAAGG + Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199608591 X:149595318-149595340 CAGGCCGAGGAGAGGCAGGAAGG - Intergenic
1199630531 X:149774042-149774064 CAGGCCGAGGAGAGGCAGGAAGG + Intergenic
1199671514 X:150152008-150152030 GAGACCAAGTAGAAGAAAGAAGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201282760 Y:12355517-12355539 CAGGCCAATTAAAATCAGGAAGG - Intergenic
1201888728 Y:18917797-18917819 CAGGACAATTGGAAGTAGGAAGG - Intergenic