ID: 951888969

View in Genome Browser
Species Human (GRCh38)
Location 3:27551553-27551575
Sequence GAGATCTGGCCACTGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888969_951888978 15 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888978 3:27551591-27551613 GCTCCTGGGGGAGGAGGTTCTGG 0: 279
1: 277
2: 118
3: 130
4: 525
951888969_951888973 1 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888973 3:27551577-27551599 GGCACTTGTAGCAAGCTCCTGGG 0: 307
1: 190
2: 139
3: 92
4: 278
951888969_951888977 9 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888977 3:27551585-27551607 TAGCAAGCTCCTGGGGGAGGAGG 0: 323
1: 289
2: 106
3: 91
4: 375
951888969_951888981 27 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888981 3:27551603-27551625 GGAGGTTCTGGAGGAACCCCTGG 0: 70
1: 279
2: 240
3: 151
4: 317
951888969_951888980 18 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888980 3:27551594-27551616 CCTGGGGGAGGAGGTTCTGGAGG 0: 291
1: 290
2: 148
3: 189
4: 1124
951888969_951888976 6 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888976 3:27551582-27551604 TTGTAGCAAGCTCCTGGGGGAGG 0: 279
1: 246
2: 232
3: 106
4: 214
951888969_951888975 3 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888975 3:27551579-27551601 CACTTGTAGCAAGCTCCTGGGGG 0: 303
1: 184
2: 210
3: 143
4: 198
951888969_951888974 2 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888974 3:27551578-27551600 GCACTTGTAGCAAGCTCCTGGGG 0: 337
1: 259
2: 196
3: 91
4: 158
951888969_951888972 0 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888972 3:27551576-27551598 TGGCACTTGTAGCAAGCTCCTGG 0: 278
1: 142
2: 126
3: 107
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951888969 Original CRISPR GAGATCTGGCCACTGTGCCA AGG (reversed) Intergenic
No off target data available for this crispr