ID: 951888974

View in Genome Browser
Species Human (GRCh38)
Location 3:27551578-27551600
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 337, 1: 259, 2: 196, 3: 91, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888969_951888974 2 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888974 3:27551578-27551600 GCACTTGTAGCAAGCTCCTGGGG 0: 337
1: 259
2: 196
3: 91
4: 158
951888967_951888974 18 Left 951888967 3:27551537-27551559 CCTGGCTGTGGGTATTCCTTGGC No data
Right 951888974 3:27551578-27551600 GCACTTGTAGCAAGCTCCTGGGG 0: 337
1: 259
2: 196
3: 91
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900395449 1:2451511-2451533 GCCCTTGGAGCCAGTTCCTGGGG - Intronic
900525485 1:3126398-3126420 GCACCTGCAGCCAGCTCCTCCGG - Intronic
900722536 1:4186685-4186707 GCACTTGCAGCCAGCTCCTGGGG + Intergenic
900840791 1:5047105-5047127 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
900847478 1:5115380-5115402 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
902050920 1:13563138-13563160 GCACTTGAAGCAAGATCCTGGGG - Intergenic
903396022 1:23002400-23002422 GCACTTGAAGCAAGATCCTGGGG + Intergenic
904393963 1:30205650-30205672 GCACTTGAAGCAAAATCCTGGGG - Intergenic
904711638 1:32434605-32434627 GCACGTGTACCAAGCTCTTGGGG - Intergenic
904996477 1:34635410-34635432 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
905060516 1:35135783-35135805 GCACTTCTAGCAAGCTCCTGGGG + Intergenic
905429293 1:37909909-37909931 GCACTAGAAGCAAGATCCTGGGG - Intronic
905499784 1:38427339-38427361 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
906378727 1:45317894-45317916 GCACTTGAAGCAAGATCCTGGGG - Intergenic
906744518 1:48212442-48212464 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
906839787 1:49124454-49124476 GCAAATGTAGCATGCTCGTGTGG - Intronic
907292637 1:53426554-53426576 GCACTTGTAGCAAACTCCTGGGG - Intergenic
907293607 1:53434504-53434526 GCACTTGAAGCAAGATCCTGGGG - Intergenic
907503563 1:54901313-54901335 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
907521263 1:55024858-55024880 GCACTTGTAGCAAACTCCTGGGG - Intergenic
908416816 1:63921326-63921348 GCATTTCTAACAAGCTCATGGGG + Intronic
908461711 1:64353420-64353442 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
908591950 1:65645328-65645350 GCACATGTAGCAAGCTCCTATGG + Intergenic
908852408 1:68388523-68388545 GCACATGTAGCAAGCTCCTGGGG - Intergenic
909035478 1:70590562-70590584 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
909223648 1:72991236-72991258 GCACATGTAGCAAGCTCCTGGGG + Intergenic
909374166 1:74921174-74921196 GCACTTGAAGCAAGATCCTGGGG - Intergenic
909551015 1:76898226-76898248 GCACTTGTAGCAAGCTCCTGGGG + Intronic
909776688 1:79492015-79492037 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
909788264 1:79642177-79642199 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
909792973 1:79699796-79699818 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
909909965 1:81247697-81247719 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
909978446 1:82070968-82070990 GCATGTGTAGCAAGCTCCTGTGG + Intergenic
910002740 1:82358312-82358334 GCATTGATACCAAGCTCCTGGGG + Intergenic
910049385 1:82957574-82957596 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
910144127 1:84058675-84058697 GCACTTGTAGAGAGCTCCTGGGG + Intergenic
911071078 1:93832318-93832340 GCACTTGAAGCAAGATCCTGGGG - Intronic
911147983 1:94570311-94570333 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
911510611 1:98804693-98804715 GCACTTGTAACAAGCTCCTTGGG + Intergenic
911570405 1:99511895-99511917 GCACTTGTAGCAAGCTCCTGTGG - Intergenic
911759778 1:101601487-101601509 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
911966932 1:104382445-104382467 GCACTTGAAGCAAGATCCTGGGG - Intergenic
912003235 1:104860354-104860376 CTACTTGCAGCAAGCACCTGGGG - Intergenic
912296479 1:108475209-108475231 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
912813569 1:112811697-112811719 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
912815305 1:112823920-112823942 GCACTCATAGCAAGCTCCTGGGG + Intergenic
913245137 1:116864390-116864412 GCACTTGAAGCAAGATCCTGGGG - Intergenic
916328863 1:163593279-163593301 GCACTTGAAGCAAGATCCTGGGG - Intergenic
917280612 1:173375304-173375326 GCAGTTGTAGCATCCTCCAGAGG - Intergenic
917437251 1:175033944-175033966 GCCCTTCTACCCAGCTCCTGGGG + Intergenic
917749657 1:178042235-178042257 GCACTTGAAGCAAGATCCTGGGG - Intergenic
918347121 1:183615905-183615927 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
918567667 1:185951752-185951774 GCACGTGTAGCAAGCTCCTGGGG + Intronic
918714401 1:187768949-187768971 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
919476403 1:198037051-198037073 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
920427338 1:205888724-205888746 GCACTTAAAGCAAGATCCTGGGG + Intergenic
920829405 1:209451193-209451215 GCACATGTAGCAAGCTCCTGGGG - Intergenic
920901526 1:210114265-210114287 GCACTTAAAGCAAGATCCTGGGG + Intronic
921212425 1:212911763-212911785 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
921459775 1:215413396-215413418 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
921520134 1:216147805-216147827 GCACGTGTAGCAAGCTCCTGGGG - Intronic
921732969 1:218597245-218597267 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
922048418 1:221968213-221968235 GCACTTGTAGCAAACTCCTGGGG - Intergenic
922049528 1:221976559-221976581 GCATGTGTAGCAAGCTCCTGTGG + Intergenic
922154064 1:223027859-223027881 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
922363541 1:224843909-224843931 GCACTTGAAGCAAGCTCCTGGGG + Intergenic
922598978 1:226835525-226835547 GCACTTGAAGCAAGATCCTGGGG - Intergenic
922877087 1:228948493-228948515 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
922906401 1:229176677-229176699 GCACTTGTAGCAAGCTCCTGTGG - Intergenic
922934827 1:229414642-229414664 GCACATGTAGCAAGCTCCTGTGG - Intergenic
923075210 1:230603487-230603509 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
923214189 1:231833663-231833685 GCACTTGTAGCAAGCTCCTGGGG + Intronic
923244757 1:232120436-232120458 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
923257268 1:232232657-232232679 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
923408618 1:233686888-233686910 TCACTTGTAGCAAGCTCCTGTGG + Intergenic
923770732 1:236935707-236935729 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
923962789 1:239103628-239103650 GCACTTGTAGCAAGCCTCTGGGG - Intergenic
924896176 1:248339683-248339705 GCGCTTATAGCAAGCTCCTGGGG + Intergenic
1062930759 10:1351006-1351028 GCACTTGTAGCAAGCTTCTCGGG - Intronic
1063106405 10:2996434-2996456 CCACTTGTAGCAAGCTCCTGGGG + Intergenic
1063363172 10:5473369-5473391 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1063509593 10:6633048-6633070 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1063527676 10:6800545-6800567 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1064663808 10:17630298-17630320 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1064886990 10:20122613-20122635 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1065437635 10:25718704-25718726 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1065443116 10:25772193-25772215 GCATGTGTAGCAAGTTCCTGGGG + Intergenic
1065858205 10:29847807-29847829 GCACCTGTAGTCAGCACCTGGGG - Intergenic
1066103392 10:32137109-32137131 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1066437210 10:35405933-35405955 GCACTTGAAGCAAGATCCTGGGG + Intronic
1067360409 10:45573470-45573492 GCACCTGAAGCAAGTTCCTGGGG - Intronic
1068058343 10:52037218-52037240 GCACATGTAGCAAGCTCCTGTGG + Intronic
1068179652 10:53502489-53502511 GCATGTGTAGCAAGCTTCTGTGG + Intergenic
1068230979 10:54169013-54169035 GCATGTGTAGCAAGCTCCTGTGG - Intronic
1068360778 10:55973458-55973480 GCACTTGAAATAAGATCCTGGGG - Intergenic
1068592338 10:58864471-58864493 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1069620362 10:69833805-69833827 GCGGTTGTAGTAAGCTCCTGCGG + Intronic
1069755732 10:70773514-70773536 GCATTTTTAACAAGCTCCCGGGG + Intronic
1070230895 10:74565947-74565969 GCACTTGTGCCAAGTTCCTAAGG - Intronic
1070474932 10:76820827-76820849 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
1071168514 10:82834830-82834852 TCACTTGCAGCAAGCTGCTTAGG + Intronic
1071187239 10:83059406-83059428 GCACTTGAAGCAAGATCCTGTGG - Intergenic
1071550785 10:86564691-86564713 GCACTTGAAGCAATATCCTGGGG + Intergenic
1071897727 10:90084494-90084516 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1071916206 10:90297263-90297285 GCATGTGTAGCAAGTTCCTGGGG - Intergenic
1072011272 10:91304941-91304963 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1072570478 10:96653973-96653995 GCATTTCTAACAAGCTTCTGGGG - Intronic
1072580265 10:96734470-96734492 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1072884530 10:99261848-99261870 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1073014024 10:100384003-100384025 GCACTTGAAGAAAGATCCTGGGG - Intergenic
1073621905 10:105058781-105058803 GCATTTTTAGCAAGCACCTCAGG - Intronic
1073709485 10:106021073-106021095 GCGCTTGTAGCAAGCTCCTGGGG + Intergenic
1073979643 10:109140426-109140448 GCAATTATAGCACTCTCCTGTGG - Intergenic
1074019033 10:109564623-109564645 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1074740784 10:116482911-116482933 GCACTTGCAGCAAGCTCCTGGGG - Intergenic
1075248703 10:120847106-120847128 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1076582009 10:131518049-131518071 GCACCTTTAGCAAGCGCATGGGG + Intergenic
1077612189 11:3650193-3650215 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1077679062 11:4222699-4222721 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1077688498 11:4319340-4319362 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1077766378 11:5163738-5163760 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1077850791 11:6073291-6073313 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1077883362 11:6368071-6368093 GCACTTGTAGCGAGCTCCTGGGG - Intergenic
1078046119 11:7915615-7915637 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1079124705 11:17710084-17710106 GCACATGTAGCAAGATCCAGAGG - Intergenic
1079230518 11:18645287-18645309 GCACTTGCAGCAAGCTCCTGGGG - Intergenic
1079447468 11:20570046-20570068 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1079672566 11:23187393-23187415 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
1079727068 11:23890636-23890658 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1079847685 11:25490673-25490695 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1080027911 11:27632538-27632560 GCACTTGTGGCAAGCTCCTGGGG + Intergenic
1080227362 11:29975666-29975688 GCACTTGTAGCAAACTCGTGGGG - Intergenic
1080994445 11:37582074-37582096 GCACTTGAAGCAAGATCTTGGGG + Intergenic
1081356811 11:42122833-42122855 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
1081668705 11:44931517-44931539 ACATTTGTAGAAAGCTGCTGAGG - Exonic
1081717299 11:45259515-45259537 GCTCTGGTAACAAGCTCCTGAGG - Intronic
1082197756 11:49324887-49324909 GCACTTGAAGCAAGATCCTGAGG + Intergenic
1083468275 11:62863882-62863904 GAACTTATGGCAAGCTCCTATGG - Intronic
1083534415 11:63455167-63455189 TCACTTGTAGCAAGCTCCTGGGG - Intergenic
1084232308 11:67761941-67761963 GCACTTGTGGCAAGCTCCTGGGG - Intergenic
1084355558 11:68635969-68635991 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1084399946 11:68937618-68937640 GCACGCCTAGCCAGCTCCTGCGG - Intronic
1084613269 11:70217731-70217753 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1084782355 11:71418617-71418639 GCACCTGTAGGAAGCATCTGTGG - Intergenic
1085570197 11:77552190-77552212 GCACTTGGAGCAAGATCCTGGGG - Intronic
1085627292 11:78083234-78083256 GCACTTGAAGCAAGATCCTGAGG - Intergenic
1085988020 11:81808472-81808494 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1086005024 11:82027478-82027500 GCACTTGTAACAAGCTCCTGGGG - Intergenic
1086134830 11:83435035-83435057 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1086136264 11:83446357-83446379 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1086550217 11:88045449-88045471 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1086658064 11:89383240-89383262 GCACTTGAAGCAAGATCCTGAGG - Intronic
1087099104 11:94347977-94347999 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1087099647 11:94351910-94351932 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1087127823 11:94643874-94643896 GCACTTGTAGCGAGCTCCTGGGG - Intergenic
1087196922 11:95311780-95311802 GCACTTGTAGAGAGCTCCTGGGG - Intergenic
1087314680 11:96590182-96590204 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1087839536 11:102907533-102907555 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1087971040 11:104484529-104484551 GAATTTCTAGCAAGCTCCTAGGG - Intergenic
1088554966 11:111052450-111052472 GTACTTGTAGCAAGCTCCTCGGG - Intergenic
1088734646 11:112718721-112718743 GTACTGGTAGCAAGTTTCTGTGG - Intergenic
1089349099 11:117811539-117811561 GCACTTGTAGTAAGCTCCTGGGG - Intronic
1089471049 11:118720453-118720475 GCACTTGTAGCAAGTTCCTGGGG + Intergenic
1089867044 11:121641378-121641400 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1089987688 11:122829380-122829402 GCACTTGTAGGAAGCTCCTGGGG - Intergenic
1090107594 11:123869052-123869074 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1090526803 11:127546186-127546208 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1090546484 11:127772530-127772552 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1090683851 11:129093341-129093363 GCACTTTTAGAAAGTTCCTAAGG - Intronic
1090850591 11:130567817-130567839 GCACATGTAGCAAGCTCCTGGGG + Intergenic
1090926933 11:131257943-131257965 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1091690735 12:2595761-2595783 GCACCTGTTGCCAGCTGCTGGGG + Intronic
1091886522 12:4020788-4020810 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1092416172 12:8291993-8292015 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1092592749 12:9966521-9966543 GCACTTTTAGCAAGCTCCTGGGG + Intronic
1092626742 12:10336383-10336405 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1092723714 12:11465624-11465646 GCACATGTAGCAAGCTCCTGTGG + Intronic
1092739318 12:11613149-11613171 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1092789714 12:12060650-12060672 GCACTTGTAGCAAGCTCCTCGGG - Intronic
1092924849 12:13263425-13263447 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1093024336 12:14232837-14232859 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1093052184 12:14516522-14516544 GCATTTTTAGCAAGCTCCATAGG + Intronic
1093071159 12:14708328-14708350 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1093268005 12:17025158-17025180 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1093321982 12:17723732-17723754 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1093358440 12:18197208-18197230 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1093578821 12:20765634-20765656 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1093584513 12:20820456-20820478 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1093812831 12:23509466-23509488 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1093951075 12:25165405-25165427 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1094316047 12:29138456-29138478 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1094400680 12:30058235-30058257 GCAGTTGGGGCAAGCTCCTGGGG - Intergenic
1094678609 12:32647488-32647510 GCAGTTCTAACAAGCTCCCGAGG + Intergenic
1094825759 12:34267895-34267917 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1095637658 12:44452054-44452076 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1095999021 12:48113586-48113608 ACACTTGAAGCAAGATCCTGGGG + Intronic
1096197159 12:49656103-49656125 GTACTTTTAACAAGCTCCTTAGG + Intronic
1096685631 12:53286592-53286614 CAACTTTTTGCAAGCTCCTGGGG + Exonic
1096907188 12:54946382-54946404 GCACTTGAAACAAGATACTGGGG + Intergenic
1097398592 12:59104097-59104119 GCACTTGTGGCAAGTTCCTGGGG - Intergenic
1097856196 12:64465118-64465140 GCACTTGTAGACAGCTACTCAGG + Intronic
1098173633 12:67770102-67770124 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1098402253 12:70087658-70087680 GCACGCGTAGCAAGCTCCTGGGG - Intergenic
1098629064 12:72705607-72705629 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1098630027 12:72712348-72712370 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
1098653823 12:73005418-73005440 GCACTTGTAGCAGGCTCCTGGGG + Intergenic
1098919910 12:76293717-76293739 GCACTTGAAGCAAGCTCCTTGGG - Intergenic
1099188719 12:79542117-79542139 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1099292097 12:80786531-80786553 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1099762591 12:86941057-86941079 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1099836094 12:87910845-87910867 ACACTTGTAGCAAGCTCCTGGGG + Intergenic
1100561364 12:95751434-95751456 GCATATGTAGCAAGCTCCTGTGG - Intronic
1100940301 12:99717445-99717467 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1101042923 12:100775245-100775267 ACACTTCTAGCAACCTCCTTTGG - Intronic
1101278394 12:103226134-103226156 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1102116738 12:110408716-110408738 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1105948626 13:25210489-25210511 GGACTTGGACCAAGGTCCTGGGG - Intergenic
1106943448 13:34800901-34800923 GCACTTGTAGCAAGCTTCTGTGG - Intergenic
1107075583 13:36318700-36318722 GCACGTGTAGCAAGCTCCTGTGG - Intronic
1107128269 13:36868182-36868204 GCATTTTTAGCAAGCTCCACTGG - Intronic
1107220291 13:37972630-37972652 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1107683137 13:42870872-42870894 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1108202700 13:48058655-48058677 GCACTTATAGCAAGCTCCTGGGG - Intronic
1108282061 13:48870577-48870599 GCACTTGGAGCAAGATCCTGGGG + Intergenic
1108513000 13:51172125-51172147 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1108742959 13:53357720-53357742 GCATTTCTAACAAGCTGCTGCGG + Intergenic
1108803867 13:54131145-54131167 GCACTTGTAGCAAGCCCCTGGGG + Intergenic
1108814131 13:54269114-54269136 GCACGTATAGCAAGCTCCTGTGG - Intergenic
1108913415 13:55581699-55581721 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1108919541 13:55658428-55658450 GCATGTGTAGCAAGCTCCTATGG + Intergenic
1108947440 13:56042569-56042591 GCATGTGTAGCAAGCTCATATGG - Intergenic
1108952943 13:56115872-56115894 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1109343586 13:61090614-61090636 GCACTTGTAGCAAGCTCCTGTGG - Intergenic
1109352922 13:61207045-61207067 GCACTTGTAGCAAGCTCCTGTGG - Intergenic
1109499298 13:63215381-63215403 GCACTTATAGCAAGCTCCTAGGG - Intergenic
1109709662 13:66144791-66144813 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1109716738 13:66229835-66229857 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1110765480 13:79276393-79276415 GCACTTGTAGGAAGCTCCTGGGG - Intergenic
1110845346 13:80185930-80185952 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1110978495 13:81868432-81868454 GCACTTGTAGCAAGCTTCTGGGG - Intergenic
1111126040 13:83911735-83911757 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1111302052 13:86360664-86360686 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1111362103 13:87189881-87189903 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1111458836 13:88516279-88516301 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
1111630444 13:90841698-90841720 GCATGTGTAGCAAGCTCCTGGGG - Intergenic
1111631698 13:90852041-90852063 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1112128243 13:96494055-96494077 GTAATTGTAGCAAGCTCCAGGGG - Intronic
1112236832 13:97644574-97644596 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1112889313 13:104211511-104211533 GCACTTGTAGCAAGCTCTTGGGG + Intergenic
1113324341 13:109267605-109267627 GCACTTGCAGCAAGCTCCTGGGG - Intergenic
1114221681 14:20702841-20702863 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1115240598 14:31248797-31248819 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1115904812 14:38193049-38193071 GCAAGTGTAGCAAGCTCCTGGGG - Intergenic
1116179681 14:41518201-41518223 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1116490582 14:45498838-45498860 GCACTTGTAGCAAGCTTCTGGGG + Intergenic
1116573459 14:46546185-46546207 GCACTTGTAGCAAGCTCTTGGGG - Intergenic
1116613518 14:47106439-47106461 GCACATGTAGCAAGCTCCTGTGG - Intronic
1116702401 14:48258836-48258858 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1116703285 14:48265828-48265850 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1116952917 14:50895429-50895451 GCACGTGTAGCAAGCTCCTGTGG - Intronic
1117174158 14:53130654-53130676 GCACTTGAAGCAAGATCCTGGGG - Intronic
1117801188 14:59446314-59446336 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1117957907 14:61136876-61136898 GCACTCGTAGCAAGCTCCTGCGG + Intergenic
1118555998 14:67022786-67022808 CCATTTGTGGCAAGCTGCTGTGG + Intronic
1119022437 14:71126584-71126606 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1119317206 14:73705749-73705771 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1119953738 14:78772708-78772730 GCATTTCTAGCAAGCTCCCAGGG + Intronic
1120251389 14:82064535-82064557 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1120438047 14:84503659-84503681 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1120539554 14:85736427-85736449 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1120618260 14:86733607-86733629 GCACTTGTTGCAAGCTCTTGGGG - Intergenic
1120659951 14:87238491-87238513 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1121193298 14:92048163-92048185 GCACTTGAAGCAAGATCCTGGGG + Exonic
1121289421 14:92762126-92762148 GCACTTGAAGCAAGATCCTGAGG - Intergenic
1121703655 14:95975206-95975228 ACACTTGTAGCAAGCTCCTGGGG - Intergenic
1121980578 14:98450578-98450600 GCACTTGTAGCAAGCTCCTAGGG + Intergenic
1122041001 14:98987457-98987479 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1122381319 14:101309125-101309147 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1123882489 15:24689033-24689055 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1125045781 15:35241028-35241050 GCACGTGTAGCAAGCTCCTGTGG - Intronic
1125131512 15:36289095-36289117 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
1125213213 15:37239649-37239671 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1125629225 15:41133766-41133788 GCACTTGAAACAAGATCCTGGGG - Intergenic
1125849095 15:42886784-42886806 GCACTTGAAGCAAGATCCTGGGG - Intronic
1126530150 15:49702590-49702612 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1126843752 15:52740845-52740867 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1126912401 15:53430286-53430308 GCACTTGTAGGAAGCTCCTGGGG + Intergenic
1127280510 15:57486843-57486865 GCAATAGTTGCATGCTCCTGAGG + Intronic
1128703512 15:69821644-69821666 GCACGTGAAGGAAGCTGCTGAGG - Intergenic
1128938145 15:71765504-71765526 GCATTTTTAGCAAGTTCCTGAGG + Intronic
1129259440 15:74356187-74356209 GCACTTGAAGCAAGATCCTGGGG - Intronic
1130724588 15:86425711-86425733 TCACTTTTAGAAAGCTCCTTGGG - Intronic
1130855119 15:87833525-87833547 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1130867134 15:87942647-87942669 GGTCTTGAAGCAAGCACCTGTGG - Intronic
1130945940 15:88550955-88550977 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1131278021 15:90998603-90998625 GCCCCTGTAGCAAGCTCCAATGG + Exonic
1131447753 15:92513769-92513791 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1131684185 15:94753032-94753054 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1131684712 15:94756735-94756757 GCACTTGTACCAAGCTCCTGGGG - Intergenic
1131882512 15:96875278-96875300 GCATGTGTAGCAAGCTCCTTGGG + Intergenic
1132263019 15:100442545-100442567 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1132340417 15:101074795-101074817 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1133066943 16:3214752-3214774 GCATTTGTAGGAACCTCCTTTGG - Intergenic
1133091515 16:3408087-3408109 GCACAGTTAGCAGGCTCCTGGGG - Intronic
1133651398 16:7816962-7816984 GCACTTGTAGCAAGCGCCTAGGG - Intergenic
1133765732 16:8836467-8836489 GCACGTGTAGCAAGCTCCTGGGG + Intronic
1133766759 16:8843534-8843556 GCACGTGTAGCAAGCTCCTGGGG + Intronic
1133869539 16:9674567-9674589 GCACTTGTAGCAATCTCCTGGGG + Intronic
1133938180 16:10285413-10285435 GCACTTGAAGCAAGCTCCTGGGG - Intergenic
1134342174 16:13356022-13356044 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1134666495 16:16022547-16022569 GCATTTCTAGCAAGCTTCCGGGG - Intronic
1135025410 16:18995583-18995605 GCACTTAGAGCAAGATCCTGGGG + Intronic
1136529955 16:30861415-30861437 GCACTTGAAGCAAGATCCTGGGG - Intronic
1138759098 16:59521082-59521104 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1138804954 16:60081091-60081113 GCACGTGTAGCAAGCTCCTAGGG - Intergenic
1139039232 16:62982597-62982619 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1139225911 16:65233286-65233308 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1139230597 16:65278703-65278725 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
1139943046 16:70619918-70619940 GCACATGTAGCAAGCTCCTGTGG + Intronic
1139943717 16:70624235-70624257 GCACGTGTAGCAAGCTCCTGGGG + Intronic
1140686346 16:77437056-77437078 GCATTTGTAGTAAGCACTTGTGG + Intergenic
1140870365 16:79100964-79100986 GCACCTGTAGAAAGGTCTTGTGG + Intronic
1141128394 16:81417468-81417490 GCATTTCTCACAAGCTCCTGGGG - Intergenic
1141321156 16:83010194-83010216 GCATTTCTAACAAGCTCCTAAGG + Intronic
1141355391 16:83340655-83340677 GCATTTCTAACCAGCTCCTGGGG + Intronic
1141865199 16:86745475-86745497 GCACTTGTAGCAAGGTCCTTGGG + Intergenic
1143414341 17:6735056-6735078 GCACTTGTAGCAAGCTCCTGAGG + Intergenic
1143970195 17:10789814-10789836 GCATTTCTAACAAGCTCCTAGGG + Intergenic
1144104676 17:11974154-11974176 GCACTTGTAGTAAGCTCCTGGGG - Intergenic
1146597901 17:34185533-34185555 GCACATGTAGCAAGCTCCTGGGG - Intergenic
1149319572 17:55470058-55470080 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1151187939 17:72377812-72377834 GCATTTCTAACCAGCTCCTGGGG - Intergenic
1151622493 17:75254833-75254855 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1151839751 17:76609405-76609427 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1154043417 18:10881515-10881537 GCAGTTTCAGCAAACTCCTGAGG - Intronic
1155173823 18:23286299-23286321 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1155697012 18:28696551-28696573 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1155941552 18:31806064-31806086 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1156237364 18:35218028-35218050 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1156251927 18:35359759-35359781 GCACTCGTAGCAAGCTCCTGGGG + Intergenic
1156302252 18:35846153-35846175 GCACTTGTAGCGAGCTCCTGGGG - Intergenic
1156924049 18:42555941-42555963 GCACTTGTAGCAAGCTCCAGGGG + Intergenic
1156938535 18:42738911-42738933 GCACTTGTAGCAAGCTCCAGGGG - Intergenic
1156958183 18:42993133-42993155 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1157906387 18:51573489-51573511 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1158336381 18:56417850-56417872 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1158394640 18:57070077-57070099 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1158576692 18:58644432-58644454 GCACTTGAAGCAAGCTCCTGGGG + Intergenic
1159164471 18:64683900-64683922 GCTCTTGTAGCAAGTTCCTGGGG - Intergenic
1159372452 18:67545996-67546018 TCAAAGGTAGCAAGCTCCTGAGG + Intergenic
1159835056 18:73326896-73326918 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1159929221 18:74294692-74294714 GTACTTGAAGCAAGATCCTGGGG - Intergenic
1161661722 19:5550730-5550752 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1161711220 19:5849349-5849371 AAACTTGTAGCAAGCTCCTGGGG - Intronic
1161712043 19:5854369-5854391 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1161739153 19:6009719-6009741 GGCATAGTAGCAAGCTCCTGTGG - Intronic
1162262215 19:9542495-9542517 GCACTTAAAGCAAGAACCTGAGG - Intergenic
1163907188 19:20157792-20157814 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1163944447 19:20522531-20522553 GCACTTGAAGCAAGATCCTGAGG + Intergenic
1164080811 19:21860061-21860083 GCACTTGAAGCAAGATGCTGGGG - Intergenic
1164152976 19:22570500-22570522 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1164202500 19:23030271-23030293 GCACTTGAAGTAAGATCCTGGGG + Intergenic
1164258766 19:23551523-23551545 GCAATTGAAGCAAGATCCTGGGG - Intronic
1164459226 19:28433313-28433335 GCACTTGTAGCAAGCTTCTGGGG + Intergenic
1165249241 19:34516253-34516275 GCACTTGAAGCAAGCTCCTGGGG - Intergenic
1165497001 19:36158868-36158890 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1165510314 19:36262934-36262956 GCACTTATAGCAAGCTCCTGGGG + Intergenic
1165835362 19:38751870-38751892 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1166498937 19:43326953-43326975 GCACGTGTAGCAAGCGCCTGGGG + Intergenic
1166905789 19:46107500-46107522 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1166927137 19:46276776-46276798 GCACTTGTAGCAAGTTCCTGGGG + Intergenic
1167046599 19:47053198-47053220 GCATGTGTAGCAAGTTCCTGGGG + Intergenic
1167221296 19:48200369-48200391 GCATTTCTAACAAGCTCCTAGGG - Intronic
1167902153 19:52630031-52630053 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1168051644 19:53833869-53833891 GCATGTGTAGCAAGTTCCTGGGG - Intergenic
1168212114 19:54898336-54898358 GTACTTGTAGCAAGCTCCTGGGG + Intergenic
1168227982 19:55010234-55010256 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
925544557 2:5003239-5003261 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
925828815 2:7876112-7876134 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
926407774 2:12572016-12572038 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
926413594 2:12628761-12628783 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
926464089 2:13167441-13167463 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
926815543 2:16795392-16795414 GCATATGTAGCAAGCTCCTGTGG + Intergenic
928655033 2:33441475-33441497 GCACTAGAAGCAAGCTCTTTAGG + Intronic
928770180 2:34696112-34696134 GCACTTGTAGCAAGCTCTTGGGG - Intergenic
928778308 2:34791967-34791989 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
928827652 2:35440548-35440570 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
928857173 2:35815340-35815362 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
928912190 2:36433057-36433079 GCACTTCTAGCGAGCTCCTTAGG + Intronic
928928567 2:36601295-36601317 GCACTTGTAGTAAGCTCCTGGGG - Intronic
929004829 2:37384421-37384443 GCACTTGTAGCAAGCTCTTGTGG + Intergenic
929076670 2:38084216-38084238 GCACTTGTAGCAAGCTCCTAGGG + Intronic
929383543 2:41380193-41380215 ACACTTGAAGCAAGATCCTGAGG - Intergenic
929684525 2:44022494-44022516 GCACTGGAAGCAAGATCCTGGGG + Intergenic
929793061 2:45037886-45037908 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
930099076 2:47589118-47589140 GCACTTGAAGCAACATCCTGGGG + Intergenic
930487360 2:52025564-52025586 GCACTTGTAGCAAGCTCCTAGGG + Intergenic
930955102 2:57195226-57195248 GCATTTGTAGCAAGCTCCTGGGG - Intergenic
930958384 2:57231148-57231170 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
931026389 2:58116866-58116888 GCACTTGTAGCAAGCTCCTGGGG + Intronic
931042618 2:58315956-58315978 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
931236944 2:60419871-60419893 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
931608922 2:64078620-64078642 GCACTTGTGGCAAGCTCCTGGGG + Intergenic
931625780 2:64254788-64254810 GCACATGTAGCAAGCTCATGGGG - Intergenic
931850428 2:66246191-66246213 GCACTTGTAGCAAGCTCCTTGGG - Intergenic
931948260 2:67333857-67333879 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
932159456 2:69447102-69447124 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
932295857 2:70622887-70622909 GCACTTGTAGCAAGCTCCTGGGG - Intronic
932358815 2:71088494-71088516 GCACTTGCAGCAAACTCCTGGGG + Intergenic
932367644 2:71163134-71163156 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
932854207 2:75217243-75217265 GCACATGTAGCAAGCTCCTGTGG + Intergenic
932973952 2:76577304-76577326 GCACGCGTAGCAAGCTTCTGTGG + Intergenic
933013095 2:77090636-77090658 GCACTTGTAGCAAGCTCCTGGGG - Intronic
933079275 2:77967369-77967391 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
933163735 2:79053647-79053669 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
933329517 2:80877917-80877939 GCACATGTAGCAAGCTCCTGGGG + Intergenic
933552390 2:83792360-83792382 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
934141266 2:89050179-89050201 GCACTTGAAGCAAGATCCCGGGG - Intergenic
934227974 2:90150365-90150387 GCACTTGAAGCAAGATCCCAGGG + Intergenic
935783031 2:106524557-106524579 GCACTTGTAAGAAGCCCCAGTGG + Intergenic
936794290 2:116187719-116187741 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
936870796 2:117132579-117132601 GCACTTGAAGCAAGATCCTGGGG - Intergenic
936882611 2:117272524-117272546 GTCCTTCTAGCAACCTCCTGTGG + Intergenic
936883338 2:117281001-117281023 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
939083135 2:137686394-137686416 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
939307416 2:140428399-140428421 GCACTTGTAGCAAGCTCCTGGGG - Intronic
939460730 2:142493283-142493305 GCACTTGAAGCAAGTTCCTGGGG + Intergenic
940107352 2:150114870-150114892 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
940182943 2:150955299-150955321 GCACTTGAAGCAAGATCCTGGGG - Intergenic
940508788 2:154586688-154586710 GCACTTGTAGCAAGCTCCGGGGG + Intergenic
940530192 2:154869581-154869603 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
940675800 2:156723519-156723541 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
940726435 2:157341553-157341575 GCATTTGAAGCAAGATCCTGGGG + Intergenic
941340403 2:164298115-164298137 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
941353389 2:164461370-164461392 GCATATGTAGCAAGCTCCTGTGG - Intergenic
941456185 2:165713946-165713968 GTATGTGTAGCAAGTTCCTGGGG + Intergenic
941935887 2:170981089-170981111 GCACTTGTAGCAAGCTTCTGGGG + Intergenic
942097089 2:172543998-172544020 GCACTTGTAGCAAGCTTCTGGGG - Intergenic
942730288 2:179055206-179055228 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
943102739 2:183508001-183508023 GCAGTTGTAGCATCCTCCAGAGG + Intergenic
943412928 2:187563929-187563951 GCACTTGTAGCAAGCTCCTGGGG + Intronic
943421581 2:187673928-187673950 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
943461189 2:188172655-188172677 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
943806654 2:192132683-192132705 GCACTTGTAGCAAGCTCCTGGGG - Intronic
943835406 2:192509740-192509762 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
943865348 2:192920319-192920341 GCACTTGTAGCAAGCTTCTGGGG - Intergenic
943951284 2:194134329-194134351 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
944251037 2:197580372-197580394 GCACTTGAAGCAAGATCCTGGGG - Intronic
944394143 2:199249185-199249207 GCACGTGTAGCCAGCTCCTGGGG - Intergenic
944876128 2:203965367-203965389 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
945153100 2:206810308-206810330 GCACATTTAGCAAGCTCCTGGGG + Intergenic
945301481 2:208219687-208219709 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
945361652 2:208901500-208901522 GCACTTGTAGGAAGCTCCTGGGG - Intergenic
945376104 2:209080331-209080353 GCACTTGTAGCAAGCTTCTGGGG - Intergenic
945394304 2:209301483-209301505 GCATGTGTAGCAAGTTCCTGGGG - Intergenic
945521547 2:210833704-210833726 GCACCTGCATCAAGCTCCTGTGG + Intergenic
945858122 2:215091848-215091870 GCACTTGAAGCAAGATCCTGGGG - Intronic
945938321 2:215924631-215924653 GCAAGTGTAGCAAGCTCCTGGGG - Intergenic
946215027 2:218177482-218177504 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
946641649 2:221790168-221790190 GCATTTCTAATAAGCTCCTGGGG + Intergenic
946781041 2:223193291-223193313 GCACTTGTAGCAAGCTCCTGGGG + Intronic
946871753 2:224091301-224091323 GCACTTGTAGCAAGCTCCCGGGG + Intergenic
946893277 2:224298935-224298957 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
948390688 2:237609215-237609237 GCACTTGTAGCAAGTTCCTGGGG - Intergenic
1168839269 20:898803-898825 GCACTTGAAGCAAGATCCTGTGG - Intronic
1168943276 20:1731193-1731215 GCACTTAAAGCAAGATCCTGGGG + Intergenic
1170068861 20:12343726-12343748 GCATGTGTAGCAAGCTCCTGTGG + Intergenic
1170106238 20:12756132-12756154 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
1170165745 20:13359221-13359243 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1170306829 20:14947679-14947701 GCATTTCTAGCAAGCTCCCAGGG + Intronic
1170325484 20:15151284-15151306 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1170680430 20:18521048-18521070 GCACTTGAAGCAAGCTCCTGCGG + Intronic
1170784970 20:19459982-19460004 GCATTTCTAACAAGCTCCTAGGG + Intronic
1170820698 20:19754596-19754618 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1172192761 20:33071857-33071879 GCACTTCTTCCAAGCTCATGGGG + Intronic
1173101915 20:40095608-40095630 GCATGTGTAGCAAGCTCCTGGGG - Intergenic
1173118875 20:40271318-40271340 GCACTTGTAGCAATTTCCTGGGG - Intergenic
1173763772 20:45587647-45587669 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1173973976 20:47173406-47173428 GCACTTCTAACCAGCTCCGGGGG - Intronic
1174657224 20:52181700-52181722 GTATTTTTAACAAGCTCCTGGGG - Intronic
1175160027 20:57001513-57001535 GCATTTCTAGCAAGCTCCCGTGG - Intergenic
1175200233 20:57271786-57271808 GCACTTCTAACTAGCTCCTGGGG + Intergenic
1175549631 20:59808735-59808757 GCATTTCTAGCAAGCTTCTAGGG + Intronic
1175715071 20:61249920-61249942 GCATTTTTAACAAGCTCCTGGGG + Intergenic
1175780499 20:61679405-61679427 GCACTTTCATCAAGTTCCTGGGG + Intronic
1177031169 21:15983242-15983264 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1177100627 21:16894436-16894458 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1177102677 21:16916248-16916270 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1177119571 21:17123753-17123775 GCCCTTGTAGCAAGCTCCTGGGG - Intergenic
1177659978 21:24070381-24070403 GGAATTCTAGCAATCTCCTGAGG - Intergenic
1177840741 21:26231490-26231512 GAGCTTGTAGCAAGCTCCTGGGG + Intergenic
1178001204 21:28163474-28163496 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1179015278 21:37590461-37590483 GCACTTGTAGCATGCTCCCGGGG + Intergenic
1179231417 21:39507047-39507069 GCACTTGTTGCAAAATCCAGGGG - Intronic
1179387560 21:40957210-40957232 GCATGTGTAGCAAGCTCCTGGGG - Intergenic
1179650363 21:42804477-42804499 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1181329554 22:22079452-22079474 GCACTTGGAGCCTGTTCCTGAGG + Intergenic
1182113953 22:27744243-27744265 GCATAGGTAGCAAGCTCCTGTGG - Intergenic
1182732278 22:32505037-32505059 GCGCGTGTAGCAAGCTCCTGGGG - Intergenic
1183635668 22:39060966-39060988 GCACTTGAAGCAAGATCCTGGGG + Intronic
949162089 3:894119-894141 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
949190393 3:1243262-1243284 GCACTTGTAGCAAGCTCCTGGGG + Intronic
949671157 3:6399939-6399961 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
949827445 3:8179276-8179298 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
950926498 3:16746577-16746599 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
951298807 3:20970962-20970984 GCACTTGTAGCAACCTCCTTGGG + Intergenic
951316313 3:21192649-21192671 ACACTTGTAGCAAGCTCCTGGGG + Intergenic
951332324 3:21382013-21382035 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
951762792 3:26163820-26163842 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
951888974 3:27551578-27551600 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
952343558 3:32464860-32464882 GCACTTGTAGCAAGCTCCTGGGG + Intronic
952663454 3:35877775-35877797 GCTCTTGTAGAAAGCTCCTGGGG + Intergenic
952896053 3:38079730-38079752 GCACTCGTAGCAAGCTCCTGGGG + Intronic
953077131 3:39581250-39581272 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
953177195 3:40563239-40563261 GCACTTGTAGCAAGCTCCTGGGG - Intronic
953599437 3:44348473-44348495 GCACTTGAAGCAAGATCCTGGGG + Intronic
953656562 3:44859134-44859156 GCACTTTAAGCAAGCTCCTGTGG + Intronic
953825697 3:46249741-46249763 GCACTTGTAGCAAGCTCCTCGGG + Intronic
953841161 3:46391188-46391210 GCACTTGAAGGAAGATCCTGGGG + Intergenic
954969265 3:54637933-54637955 GCATGTGTAGCAAGTTCCTGGGG + Intronic
955021789 3:55128765-55128787 GCACTTGGTGAAAGCACCTGGGG - Intergenic
955253368 3:57305938-57305960 GCACTTGTAGCAAGCTCCTGGGG - Intronic
956018878 3:64912712-64912734 GCATTTGTAACAAGCTCCCCAGG - Intergenic
956156032 3:66298042-66298064 GCATTTCTAGCAAGTTCCTAGGG - Intronic
956548986 3:70438313-70438335 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
956709220 3:72025248-72025270 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
957059897 3:75473482-75473504 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
957201568 3:77142741-77142763 CCCCTTGTAGCAAGCTCTAGAGG - Intronic
957295237 3:78326062-78326084 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
957317310 3:78586597-78586619 GCATATGTAGCAAGCTCCTGGGG + Intergenic
957394370 3:79620073-79620095 GCACTTGAAGCAAGATCTTGAGG - Intronic
957451440 3:80387140-80387162 GCACTTGAAGCAAGATCCTTTGG - Intergenic
957675249 3:83356571-83356593 GAACTTGAAGTAAGATCCTGGGG + Intergenic
957904842 3:86541832-86541854 GCACTTGAAGTAAGATCCTGCGG + Intergenic
957985690 3:87571616-87571638 GCACTTGAAGCAAGATCCTGGGG - Intergenic
958421957 3:93940060-93940082 GCACTTGAAGCAAGATCCTGGGG - Intronic
959288349 3:104443369-104443391 GCACGTGTAGCAAGCTCTTGGGG + Intergenic
959485772 3:106926180-106926202 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
959543693 3:107570092-107570114 GCACTTGAAGCAAGATCCTGGGG + Intronic
959693871 3:109229004-109229026 GCACTTGTAGAAATATACTGTGG + Intergenic
959972265 3:112421015-112421037 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
959992882 3:112648039-112648061 ACACATGTAGCAAGGACCTGTGG - Intronic
960282875 3:115796956-115796978 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
960310112 3:116108769-116108791 GCACTTGTAGCAAGCTCCTGGGG + Intronic
961164760 3:124756003-124756025 GTACGTGTAGCAAGCTCCTGGGG + Intergenic
961293512 3:125865963-125865985 GCACTAGTAGCAAGCTCCTGGGG - Intergenic
961711623 3:128832642-128832664 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
961730589 3:128961965-128961987 GCACTTGTAGCAAGCTCCTGGGG - Intronic
961881049 3:130061532-130061554 ACACTTGTAGCAAGCTCCTGGGG - Intergenic
962022185 3:131512558-131512580 GCACTTAAAGCAAGATCCTGGGG + Intergenic
962205568 3:133431388-133431410 GCACTTGAAGCAAGCTCCTGGGG - Intronic
962660635 3:137597733-137597755 GCACCTTTAGCAAGCTCCTGGGG - Intergenic
962720198 3:138166688-138166710 GGACTTGTAGGTAGTTCCTGTGG - Intronic
963058625 3:141207223-141207245 GCACTTGTAGGAAGCTCCTGGGG - Intergenic
963111838 3:141694737-141694759 GCACTTGAAGCAAGATCCTGGGG + Intergenic
963425219 3:145115239-145115261 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
963456659 3:145554626-145554648 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
963468616 3:145712657-145712679 ACACTTGTAGCAAGCTCCTAGGG - Intergenic
963485957 3:145934795-145934817 GCACTGGTGGCAACCTCCTTAGG - Intergenic
963520451 3:146355807-146355829 GCACTTGTAGCAAGCTCCTAGGG - Intergenic
963521626 3:146364312-146364334 GCACTTGTAGCAAACTCCTGGGG - Intergenic
963663346 3:148153910-148153932 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
963684333 3:148416607-148416629 GCACATGTAGCAAGCTCCTGGGG - Intergenic
963973361 3:151453696-151453718 GCAATCGTGTCAAGCTCCTGAGG + Exonic
964067876 3:152599599-152599621 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
964067899 3:152599702-152599724 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
964125451 3:153230144-153230166 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
964300251 3:155278633-155278655 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
964722381 3:159780188-159780210 GCATTTGCAGCAAGGTCCTCAGG + Intronic
964906511 3:161725312-161725334 GCACTTGTAGCAAGCTTCTAGGG + Intergenic
964983637 3:162714661-162714683 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
964984869 3:162725974-162725996 GCACTTGTAGCAAGCTACTGGGG + Intergenic
965070331 3:163909802-163909824 ACACTTGTAGCAAGCTCCTGGGG - Intergenic
965105227 3:164345570-164345592 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
965262650 3:166504236-166504258 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
965286730 3:166827554-166827576 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
965336330 3:167433474-167433496 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
965624880 3:170675973-170675995 GCACTTATAGCAAGCTCCTGGGG + Intronic
965626308 3:170686775-170686797 GCACTTGTAGCAAGCTCCTGGGG + Intronic
965640038 3:170821409-170821431 GCACTTATAGCAAGCTCCTGGGG + Intronic
965713410 3:171578673-171578695 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
965861968 3:173159359-173159381 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
966066846 3:175829973-175829995 GCACTTGTAGCAAGCTCCTGCGG - Intergenic
966085433 3:176063594-176063616 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
966105083 3:176325074-176325096 GCACTTGCAGCAAGCTCCTGGGG + Intergenic
966232846 3:177669290-177669312 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
966279305 3:178209791-178209813 GCACTTGTAGGAAGCTCCTGGGG - Intergenic
967005360 3:185377983-185378005 GCACTTGTAGCAAGCTCCTGGGG + Intronic
967212164 3:187178980-187179002 GCACGTGTAGCAAGCTCCTGTGG + Intronic
967244165 3:187469722-187469744 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
967496223 3:190146764-190146786 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
967561386 3:190922364-190922386 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
967624649 3:191669939-191669961 GCACGTGTAGCAAGCTCTGTGGG + Intergenic
967643828 3:191898820-191898842 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
967658105 3:192074536-192074558 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
967740487 3:192997942-192997964 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
968993385 4:3929637-3929659 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
969003810 4:4003667-4003689 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
969654098 4:8486233-8486255 GCACTTGTAGCAAGCTCCTGGGG + Intronic
969749057 4:9096518-9096540 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
969810117 4:9641158-9641180 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
970029232 4:11657184-11657206 GCACATGTAGCAAGCTCCTGGGG + Intergenic
970042092 4:11808532-11808554 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
970087549 4:12366021-12366043 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
970256420 4:14173981-14174003 GTACTTGTAGCAAGCTCCTGGGG + Intergenic
970532737 4:16999921-16999943 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
970854045 4:20633750-20633772 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
971123182 4:23725477-23725499 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
971180565 4:24325469-24325491 ACACTTGTAGCAAGCTCCTGGGG - Intergenic
971200142 4:24503266-24503288 GCACTTGTAGCAAGCTCCTGTGG - Intergenic
971552651 4:27976223-27976245 GCACTTGAAGCAAGATCCTGGGG - Intergenic
972070812 4:35018208-35018230 ACACTTGAAGCAAGATCCTAGGG + Intergenic
972071136 4:35020237-35020259 GCACTTGAAACAAAATCCTGGGG + Intergenic
972132847 4:35859556-35859578 GCAGTTGTAGCATCCTCCAGAGG + Intergenic
972648244 4:40990610-40990632 GGAGTTGTGGCAAGCTCATGGGG + Intronic
973649371 4:52982804-52982826 GCACATGTAGCAATCCACTGGGG + Intronic
973751126 4:54022062-54022084 GCACTTGAAGCAAGCTCCTGGGG - Intronic
973908482 4:55554162-55554184 GCATTTCTAACAAGCTCCTTAGG + Intergenic
974428397 4:61767743-61767765 GCATGTGTAGCAAGTTCCTGGGG + Intronic
974903778 4:68032872-68032894 GCACGTGAAGCAAGATCCTGAGG - Intergenic
975312472 4:72918021-72918043 GCCCTTGAATCAAGCACCTGTGG - Intergenic
975409318 4:74030932-74030954 CCACTTCTTGCAAGCTCCTAAGG - Intergenic
975865087 4:78717313-78717335 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
975933886 4:79557432-79557454 GCATGTGTAGCAAGCTCCTGTGG + Intergenic
976558572 4:86476846-86476868 GCACTTGTAGCAAGCTCCTGGGG - Intronic
976696539 4:87924124-87924146 GCACATGTAGCAAGCTCCTGTGG - Intergenic
976739956 4:88347202-88347224 GCACTTGAAGCAAGATCCTGGGG + Intergenic
976884570 4:89968247-89968269 GAACTTGTAGCAAGCTCCTCGGG + Intergenic
977010317 4:91626346-91626368 GCACTTGTGGCAAGCTCCTGGGG - Intergenic
977012923 4:91658077-91658099 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
977062507 4:92274945-92274967 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
977075204 4:92442416-92442438 GCAAGTGTAGCAAGCTCCTTGGG + Intronic
977198426 4:94088079-94088101 GTACTTGTAGCAAGCTCCTGTGG + Intergenic
977217153 4:94296670-94296692 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
977225341 4:94386923-94386945 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
977782437 4:100995234-100995256 GCACTTGAAGCAAGTTCCCGGGG + Intergenic
978001118 4:103557218-103557240 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
978031485 4:103943397-103943419 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
978303228 4:107293875-107293897 GCACTTGAAGCAAGATCCTGGGG + Intergenic
978438612 4:108711283-108711305 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
979054621 4:115979108-115979130 GCAATTATAGGAAGCTCCTGGGG + Intergenic
979146620 4:117254356-117254378 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
979149458 4:117291418-117291440 GCCCATGTGGCAAGCTACTGAGG + Intergenic
979379943 4:119996177-119996199 GCACATGCAGCAAGCTCCTGTGG - Intergenic
979895157 4:126148591-126148613 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
980003351 4:127514901-127514923 GCACTTGTAACAAGCTCCTGGGG + Intergenic
980111925 4:128644309-128644331 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
980284948 4:130769616-130769638 GCACTTGTAGCAAGTTTCTGGGG - Intergenic
980388926 4:132120456-132120478 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
980472440 4:133267147-133267169 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
980527870 4:134014430-134014452 GCACTTGTAGCAAGTTCCTGGGG - Intergenic
980575635 4:134681361-134681383 GCACTTGTAGCAAGCTACTGGGG + Intergenic
980611775 4:135170745-135170767 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
980903939 4:138930127-138930149 GCACTTGTAGCAAGCTACTGGGG - Intergenic
981005049 4:139866030-139866052 ACAAATGTAGGAAGCTCCTGAGG + Intronic
981040245 4:140215750-140215772 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
981121637 4:141057976-141057998 GCATTAATAGCAAGCTACTGTGG + Intronic
981482726 4:145255000-145255022 GAACTTGAAGCAAGATCCTGGGG + Intergenic
981525211 4:145701356-145701378 GCACTTGTAGCAAGCTCCTGGGG - Intronic
981539726 4:145835001-145835023 GCACGTGTAGCAAGCTCCTGTGG - Intronic
982083966 4:151816057-151816079 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
982318811 4:154058536-154058558 GCACTTGAAGCAAGATCCTGAGG - Intergenic
982396717 4:154922293-154922315 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
982414195 4:155111916-155111938 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
982535448 4:156602538-156602560 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
983023872 4:162711357-162711379 GCACTTGTGGCAAGCTCCTGGGG - Intergenic
983055489 4:163095344-163095366 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
983345557 4:166522778-166522800 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
983360408 4:166718556-166718578 GCATGTGTAGCAAGATCCTGTGG - Intergenic
983414707 4:167439259-167439281 GCAAGCGTAGCAAGCTCCTGTGG + Intergenic
983448061 4:167878526-167878548 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
983659573 4:170118710-170118732 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
983707675 4:170679748-170679770 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
984099046 4:175464889-175464911 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
984165355 4:176298303-176298325 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
984322189 4:178209378-178209400 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
984393613 4:179168344-179168366 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
984411728 4:179405474-179405496 GCACTGGAAGCAAGATCCTGGGG - Intergenic
984437264 4:179722702-179722724 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
984700673 4:182816778-182816800 GCACATGTAGCAAGCTCCTGTGG - Intergenic
985057395 4:186047652-186047674 GCACTTGTAGCAAGCTCTTGGGG + Intergenic
985389869 4:189482918-189482940 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
985582356 5:705045-705067 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
986193537 5:5517811-5517833 GCACTTGTAGCAAGCTCCTGTGG - Intergenic
986388881 5:7265841-7265863 GCACATGTAGCAAGCTCCTGTGG - Intergenic
986502640 5:8416352-8416374 GCACTTGAAGCAAGATCCTGGGG - Intergenic
986555041 5:9002000-9002022 GCACTTGCAGCAAGCTCCTGGGG + Intergenic
986905775 5:12492057-12492079 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
986919585 5:12665994-12666016 GCAGGTGTAGCAAGCTCCTGTGG + Intergenic
987282041 5:16422270-16422292 ACACTTGTAGCAAGCTTCTGGGG - Intergenic
987486837 5:18535931-18535953 GCATGTGTAGCAAGCTCCTGGGG - Intergenic
987487505 5:18540565-18540587 GCACTTGTAGCAATCTCCTGTGG - Intergenic
987498121 5:18672313-18672335 GCATGTGTAGCAAGCTCCTGTGG + Intergenic
987755833 5:22097100-22097122 GCACTTGTAGCAAGCTCCTGAGG - Intronic
988199098 5:28047895-28047917 TCACTTGGAGCAAGATCCTGGGG - Intergenic
988376234 5:30439439-30439461 GAACATGAAGCAGGCTCCTGGGG + Intergenic
989107397 5:37876467-37876489 GCCCATGTGGCAAGGTCCTGAGG + Intergenic
989475960 5:41872879-41872901 ACACCTGTAGCCAGCTACTGGGG + Intergenic
989659926 5:43788371-43788393 GCACTTGAAGCAAGATTCTGGGG - Intergenic
989688900 5:44118189-44118211 GCACTTGAAGCAAGATCCTGGGG + Intergenic
990826787 5:59909369-59909391 GCAATTTTAACAAGCTCCTTAGG + Intronic
991830742 5:70685309-70685331 GCTCTTGTAACAAGCTTCTCTGG + Intergenic
992394663 5:76359610-76359632 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
992452002 5:76883838-76883860 GCACTTGTAGCAAGCTCCTGGGG + Intronic
992960831 5:81955514-81955536 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
993192714 5:84700735-84700757 GCATGTGTAGCAAGCTCTTGTGG - Intergenic
993836708 5:92826231-92826253 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
994295149 5:98081321-98081343 TCACTTGTAGCAAGCTCCTGGGG - Intergenic
994324876 5:98436824-98436846 GCACTTGAGGCAAGTACCTGGGG - Intergenic
994375785 5:99014762-99014784 GCACTTGAAGGGAACTCCTGGGG + Intergenic
994532544 5:100987708-100987730 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
994556939 5:101317192-101317214 GCACTTGTAGCAAGCTCCTCGGG - Intergenic
994775685 5:104033873-104033895 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
994989554 5:106980636-106980658 GCACTTGTAGCAAGCTCATGGGG - Intergenic
995125160 5:108571911-108571933 GCACTTGTAGCAAGCTCTTGGGG + Intergenic
995296677 5:110532097-110532119 GCACTTGTAGCAAGCTCCTGGGG - Intronic
995769384 5:115652787-115652809 GCACTTGAAACAATCTCCTGGGG - Intergenic
995899364 5:117049819-117049841 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
996052674 5:118950662-118950684 GCACTTGAAGCAAGATCCTGGGG + Intronic
996203257 5:120701045-120701067 GCACATGTAGCAAGCTCCTGTGG + Intergenic
996344820 5:122477059-122477081 TCACATGTAGCAAGCTCCTGTGG + Intergenic
996358622 5:122622322-122622344 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
996509900 5:124306049-124306071 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
996528055 5:124499310-124499332 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
996745445 5:126843013-126843035 GCAAGTGTAGCAAGCTCCTGTGG + Intergenic
996878052 5:128261805-128261827 GCACTCGTAGCATGCTTCTGGGG + Exonic
996912445 5:128670675-128670697 GCCCTTGTAGCAGGCTCCTGGGG + Intronic
996917682 5:128731802-128731824 GCACTTGAAGCAAGATCCTGGGG - Intronic
997028134 5:130090393-130090415 GCACTGGTAGCCAGGTACTGTGG - Intronic
997678861 5:135735129-135735151 GCACTTGAAGCAAGTTCCTTGGG + Intergenic
997746402 5:136303569-136303591 GCACTTGTAGCAAGCTCCTGGGG - Intronic
997769679 5:136543067-136543089 GCACACGAAGCAAGCTCCTATGG + Intergenic
997772643 5:136568802-136568824 GCACATGTAAAAAGCTCCTGGGG + Intergenic
998358278 5:141560310-141560332 TCACTGGAAGCAAGCACCTGAGG + Intronic
998693702 5:144614792-144614814 GCACATGTAGCAAGCTCTTGGGG + Intergenic
998995392 5:147865531-147865553 GCACGTGTAGCAAGCTCCTCTGG - Intergenic
999618869 5:153453164-153453186 GCACGTGTAGCAAGCTTCTGGGG + Intergenic
1000438587 5:161242223-161242245 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1000439722 5:161250748-161250770 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1000519404 5:162278831-162278853 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1000606931 5:163336280-163336302 GCACTTGAGGCAAGATCCTGGGG - Intergenic
1000885320 5:166742545-166742567 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1000935641 5:167301342-167301364 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1001125801 5:169018201-169018223 ACATTTTTTGCAAGCTCCTGGGG + Intronic
1001206647 5:169769589-169769611 GCAATTTTAGCAAACTCCTCAGG - Intronic
1001218169 5:169875221-169875243 GCAGTTGCAGCAAGCTCCCTGGG - Intronic
1001331448 5:170765488-170765510 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1002610959 5:180418180-180418202 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1003046179 6:2734917-2734939 GCATTTGTAGCCAGCTCCCAGGG + Intronic
1003430165 6:6031237-6031259 GCACTTGTAGTAAGCTCCTGGGG + Intergenic
1004003290 6:11615371-11615393 GCATTTCTAACAAGCTCCAGAGG - Intergenic
1004106268 6:12669633-12669655 GCACTTGTGGCAAGCTCCTGTGG - Intergenic
1004283522 6:14300406-14300428 GGATATGTAGCAAGCTCCTCGGG + Intergenic
1004290908 6:14366403-14366425 GCATTTCTAGCAAGCTCCATGGG - Intergenic
1004507995 6:16262447-16262469 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1004768573 6:18757520-18757542 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1004837003 6:19541160-19541182 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1004980639 6:21019618-21019640 GCACTTGTAGCAGCAGCCTGTGG + Intronic
1005014656 6:21364962-21364984 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1005786573 6:29250661-29250683 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1006408131 6:33856893-33856915 ACGCTTGTGGCTAGCTCCTGTGG + Intergenic
1006523536 6:34585968-34585990 GCATTTCTAGCAAGCTCCCATGG - Intergenic
1008476527 6:51940439-51940461 GCACTTGTAGTAAGCTCCTGGGG - Intronic
1008850212 6:56014269-56014291 GCACTTGTAGCAAGCTCCTTGGG + Intergenic
1009269822 6:61602358-61602380 GCACTCGTAGCAAGATCCTGGGG - Intergenic
1009359358 6:62793760-62793782 GCACTCGTAGCAAGCTCCTGAGG - Intergenic
1009379146 6:63007570-63007592 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1010071723 6:71752002-71752024 GCACTTGTAGCAAGTTCCTGGGG + Intergenic
1010586695 6:77664010-77664032 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1010826911 6:80485892-80485914 GCACTTGTAGCAAACTCCTGGGG + Intergenic
1010829689 6:80513760-80513782 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1010841313 6:80651252-80651274 GCACTTCTAGCAAGCTCCTGGGG + Intergenic
1010894544 6:81348592-81348614 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1011770943 6:90673667-90673689 GCAAGTGTAGCAAGCTCCTGGGG + Intergenic
1012014389 6:93833533-93833555 GCAAGTGTAGCAAGCTCCTGCGG + Intergenic
1012066542 6:94557399-94557421 GCAAGTGTAGCAAGCTCCTGCGG + Intergenic
1012315827 6:97781854-97781876 GCACAGGTAGCAAGCTCCTGTGG - Intergenic
1012675100 6:102104212-102104234 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1012689576 6:102295181-102295203 GCACGTGTAGCAGGCTGCTGTGG - Intergenic
1013407887 6:109859210-109859232 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1013808084 6:114015767-114015789 GCACTTGAAGCAAGAACCTGGGG + Intergenic
1013843680 6:114425778-114425800 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1013891704 6:115034136-115034158 GCATGTGTAGCAAGCTCCTGGGG - Intergenic
1014360159 6:120465721-120465743 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1014396070 6:120927445-120927467 ACACTTGTAGCAAGCTCCTGTGG - Intergenic
1014454870 6:121623894-121623916 GCACATGTAGCAAGCTCCTGTGG + Intergenic
1014555849 6:122842084-122842106 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
1014612085 6:123558897-123558919 GCACTTGTGGCAAGGTCCTGGGG - Intronic
1014614672 6:123585743-123585765 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1014718897 6:124894292-124894314 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1014793990 6:125705316-125705338 GCACATGTAGCAAGCTCCTGGGG + Intergenic
1014891545 6:126851009-126851031 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1015266736 6:131297711-131297733 GCACATGTAGCAAGCTCCTGGGG - Intergenic
1015269658 6:131325658-131325680 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1015271374 6:131341136-131341158 GCACTTGTAGTAAGCTCCTGGGG - Intergenic
1015278154 6:131405068-131405090 GCACATGTAGCAAGCTCCTGGGG - Intergenic
1015288040 6:131507737-131507759 GCACGTGTAGCAAGCTCCTGTGG + Intergenic
1015323831 6:131903941-131903963 GCACGTGTAGTAAGCTCCTGTGG - Intergenic
1015801376 6:137064780-137064802 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1016114140 6:140260865-140260887 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1016204537 6:141455085-141455107 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1016248863 6:142018063-142018085 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1016518807 6:144925427-144925449 GCATGTGTAGCAAGCCCCTGGGG - Intergenic
1016535758 6:145106604-145106626 ACACTTGTAGCAAGCTCCTGGGG + Intergenic
1016650290 6:146453870-146453892 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1016853270 6:148642055-148642077 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1017269815 6:152492469-152492491 GCACTTGAAGCAAGATCCTGGGG - Intronic
1017389499 6:153923740-153923762 GCACGGGTAGCAAGCTCCTGGGG - Intergenic
1017708500 6:157146416-157146438 GCCCCTGAAGCCAGCTCCTGAGG + Intronic
1017779330 6:157704102-157704124 GCACTTGTAGCAACCTCCTGGGG + Intronic
1018077598 6:160230750-160230772 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1018084495 6:160290026-160290048 GCACCTGTAGCAAGCTCCTGGGG + Intergenic
1018678529 6:166243590-166243612 GCACTTCTAGCAAGTTTCAGGGG + Intergenic
1020316051 7:6906045-6906067 ACACTTGTAGCAAGCTCTTGGGG - Intergenic
1020532713 7:9356874-9356896 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1020541140 7:9462010-9462032 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1020794215 7:12661822-12661844 GCACTTGAAGCAAGCTCCTGGGG - Intergenic
1021393624 7:20122858-20122880 GCACTTGTAGCAAGCTTCTGGGG - Intergenic
1021429850 7:20547704-20547726 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1021637318 7:22705499-22705521 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1021660626 7:22915374-22915396 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1021810664 7:24398532-24398554 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1021977894 7:26027642-26027664 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1022372874 7:29787102-29787124 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1022529693 7:31059327-31059349 GCAGTTTTCCCAAGCTCCTGGGG + Intronic
1022572791 7:31470482-31470504 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1022710045 7:32841358-32841380 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1022799397 7:33761376-33761398 GCTTTTCTATCAAGCTCCTGGGG + Intergenic
1022854708 7:34303347-34303369 GCACTTGTAGCAAGTTCCTGGGG + Intergenic
1023698885 7:42874062-42874084 GCACTTGTAACAAGTTCCTGGGG + Intergenic
1024676454 7:51641920-51641942 GCACTCGTGGCAAGCATCTGTGG + Intergenic
1024739252 7:52337100-52337122 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1024977227 7:55125066-55125088 GCATTTCCAGCAGGCTCCTGGGG + Intronic
1026954207 7:74366485-74366507 GCACCTGTATCAATTTCCTGGGG + Intronic
1027157887 7:75781408-75781430 GCACTTGAATCAAGATCCTGGGG - Intronic
1027158317 7:75784184-75784206 GCACTTATAGCAAGCTCCTGGGG - Intronic
1027851946 7:83461920-83461942 GCACATGTAGCAAGCTCCTGGGG - Intronic
1028589909 7:92483243-92483265 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1028670511 7:93396186-93396208 GCACTTGCAGCAAGCTCCTGGGG - Intergenic
1028690179 7:93642116-93642138 GCACTTGCAGCAAGCTCCTGGGG - Intronic
1029500215 7:100924425-100924447 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1030163609 7:106531856-106531878 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1030441686 7:109595481-109595503 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1030445782 7:109645573-109645595 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1030623162 7:111814580-111814602 GCACTTCTAACAAGCTCCAGCGG + Intronic
1030751497 7:113237033-113237055 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1030947302 7:115739483-115739505 ACACTTGTAGCATTCTCCAGAGG - Intergenic
1031004669 7:116457739-116457761 GCACGTGTAGCAAGCTCCTGGGG - Intronic
1031364745 7:120889067-120889089 GCACCTGTAGCAAGCTCCTGGGG + Intergenic
1031399986 7:121317827-121317849 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1031422454 7:121567434-121567456 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1031525593 7:122819176-122819198 GCACATGTAGCAAGCTCCTGTGG - Intronic
1031685847 7:124731294-124731316 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1031727931 7:125262357-125262379 GCACTTATAGCAAGCTCCTGGGG + Intergenic
1031776325 7:125912244-125912266 GCACATGTAGCAAGTTCCTGTGG - Intergenic
1031777345 7:125919869-125919891 GCACTTGTAGCAAGCTCTTGGGG - Intergenic
1033084718 7:138331284-138331306 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1033088558 7:138364806-138364828 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1033422002 7:141211880-141211902 GCACTTGTAGCAAGTTCCTAGGG + Intronic
1033465033 7:141582240-141582262 GCACTTGAAGCAAGTTCCTGGGG + Intronic
1033625588 7:143107077-143107099 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1033675950 7:143540677-143540699 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1033695885 7:143788762-143788784 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1033909467 7:146246834-146246856 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1034084832 7:148313505-148313527 GCACTTGTAGCAAGCTCCCGGGG + Intronic
1035880663 8:3241671-3241693 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1036070922 8:5440096-5440118 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1036281483 8:7404693-7404715 GCATATGTAGCAAGCTCCTGGGG - Intergenic
1036339986 8:7906879-7906901 GCATATGTAGCTAGCTCCTGGGG + Intergenic
1036372132 8:8170862-8170884 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1036472329 8:9062890-9062912 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1036639494 8:10573524-10573546 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1036878769 8:12494779-12494801 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1038721131 8:30036421-30036443 GCACATGCAGCATGCTCCTGTGG + Intergenic
1038800296 8:30743498-30743520 GCACTTCTCCCAAGCTACTGAGG - Intronic
1040017318 8:42710192-42710214 GCACTTATAGTCAGCTCCTTGGG + Intronic
1041917533 8:63151752-63151774 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1042453558 8:68975427-68975449 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1042706083 8:71666660-71666682 GCACTTGAAGCAAGATCTTGGGG - Intergenic
1042707370 8:71677167-71677189 GCGCGTGTAGCAAGCTCCTGGGG - Intergenic
1043353670 8:79389560-79389582 GCACGTGTAGCAAGCTCCTGGGG + Intergenic
1043435111 8:80230336-80230358 GCATTTCTAACAAGCTCCTGGGG + Intronic
1043597454 8:81901992-81902014 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1043717896 8:83508596-83508618 GTAGTTGTGGCAAGCTCCTGGGG + Intergenic
1043720907 8:83546225-83546247 GCACTTGAAGCAAGATCCTGGGG - Intergenic
1043737868 8:83769356-83769378 TCACCTGTACCAGGCTCCTGTGG + Intergenic
1043837738 8:85065228-85065250 GCACTTATAGCAAGCTCCTGGGG - Intergenic
1044148516 8:88745670-88745692 GCACGTGTAGCAAGCTCTTGGGG + Intergenic
1044258614 8:90093659-90093681 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1044417085 8:91950223-91950245 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1044921992 8:97177330-97177352 GCACATGTAGCAAGCTCCTGGGG - Intergenic
1044925159 8:97203174-97203196 GCATGTGTAGCAAGCTCCTGGGG - Intergenic
1045197522 8:99946125-99946147 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1045356877 8:101397126-101397148 GCACATGTGGCCGGCTCCTGTGG - Intergenic
1045644782 8:104288189-104288211 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1046074909 8:109303066-109303088 GCACTTGAAGCAAGATCCTTGGG - Intronic
1046294120 8:112198078-112198100 GCACTCGTAGCAAGCTCCTGGGG - Intergenic
1046386341 8:113512968-113512990 GCATGTGTAGCAAGCTCCTGTGG + Intergenic
1046440013 8:114243592-114243614 GCACGTGTCGCAAGCTCCTGGGG - Intergenic
1046443248 8:114284247-114284269 GCACGTGTAGCAAGTTCCTGTGG - Intergenic
1046512085 8:115214481-115214503 GCATGTGTAGCAAGCTCCTGTGG - Intergenic
1047699347 8:127433983-127434005 GCACATGTAGCAAGCTCCTGGGG - Intergenic
1047829543 8:128615363-128615385 GTACTTGTAGCAAGCTTCTAGGG + Intergenic
1047856374 8:128916674-128916696 GCATTTGTGGCAAGCTCCTGGGG - Intergenic
1048097611 8:131312460-131312482 GCACTTGTAGCAAGCTCTGGGGG - Intergenic
1048135472 8:131742976-131742998 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1048143773 8:131821440-131821462 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1048168432 8:132083692-132083714 GCACATGTAGCAAGCTCCTGTGG + Intronic
1048585419 8:135770596-135770618 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1048728419 8:137411730-137411752 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1048764235 8:137828271-137828293 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1049868817 8:144957714-144957736 GCACCTGTAGCAAGCTCCTGGGG + Intergenic
1050117603 9:2277822-2277844 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1050140482 9:2511689-2511711 GCACTTGAAGCAAGATCCTGTGG - Intergenic
1050258106 9:3814606-3814628 GCACTTGTAGCAAGCTTCTGGGG + Intergenic
1050896075 9:10887022-10887044 GCACTTACAGCAAGCTCCTGGGG - Intergenic
1051052627 9:12950577-12950599 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1051200686 9:14619029-14619051 GCACTCGTTGGAAGATCCTGTGG - Exonic
1051849284 9:21489156-21489178 GCACTTGCAGCAAACTCCTGGGG + Intergenic
1051953405 9:22662022-22662044 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1052163084 9:25289928-25289950 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1052191837 9:25671182-25671204 ACACTTATAGCAAGCTCTTGAGG - Intergenic
1052653335 9:31328670-31328692 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1052720640 9:32167966-32167988 GCACTTGCAGCAAGCTCCTGGGG + Intergenic
1053058033 9:35005744-35005766 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1053059920 9:35022762-35022784 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1053078460 9:35154687-35154709 ACACTTGAAGCAAGATCCTGAGG + Intergenic
1053573001 9:39329316-39329338 GCTCTTGTTGCCAGTTCCTGAGG + Intergenic
1053624349 9:39853503-39853525 GCTCTTGTTGCCAGTTCCTGAGG + Intergenic
1053880519 9:42589724-42589746 GCTCTTGTTGCCAGTTCCTGAGG - Intergenic
1053892150 9:42704606-42704628 GCTCTTGTTGCCAGTTCCTGAGG + Intergenic
1054094565 9:60888025-60888047 GCTCTTGTTGCCAGTTCCTGAGG + Intergenic
1054116034 9:61163937-61163959 GCTCTTGTTGCCAGTTCCTGAGG + Intergenic
1054124143 9:61289695-61289717 GCTCTTGTTGCCAGTTCCTGAGG - Intergenic
1054219546 9:62397194-62397216 GCTCTTGTTGCCAGTTCCTGAGG - Intergenic
1054231168 9:62511979-62512001 GCTCTTGTTGCCAGTTCCTGAGG + Intergenic
1054591723 9:67018607-67018629 GCTCTTGTTGCCAGTTCCTGAGG - Intergenic
1054807487 9:69408207-69408229 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1055233063 9:74087919-74087941 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1055347717 9:75355235-75355257 GCACTTGTGGCAAGCTCCTGGGG + Intergenic
1055626723 9:78183063-78183085 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1055810047 9:80139667-80139689 GCACATGTAGCAAGCTCCTGGGG - Intergenic
1055881748 9:81011263-81011285 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1056044736 9:82704166-82704188 GCACTTGTAGCAAGCTCCTAGGG + Intergenic
1056061160 9:82886013-82886035 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1056323886 9:85460902-85460924 GCACGTGTCGCAAGCTCCTGGGG - Intergenic
1056363709 9:85882941-85882963 GCACTTAAGGCAAGATCCTGGGG - Intergenic
1056522448 9:87413182-87413204 GCATGTGTCGCAAGCTCCTGTGG - Intergenic
1056882981 9:90414831-90414853 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1056972867 9:91222956-91222978 CCACTTATAGCATGATCCTGAGG + Intronic
1057234847 9:93349861-93349883 GCACGTGTAGCAAGCTCCTGGGG - Intergenic
1057377994 9:94542083-94542105 GCACTTGTAGCAAGCTCCTTGGG - Intergenic
1057623131 9:96654701-96654723 TCACTTGTAAGAAACTCCTGGGG + Exonic
1057684003 9:97217099-97217121 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1057812580 9:98269265-98269287 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1057982084 9:99672415-99672437 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1058026206 9:100144148-100144170 GCACTTGTAGCAAGCTTCTTGGG + Intronic
1058275795 9:103039089-103039111 GCACTTATGCCAAGTTCCTGTGG - Intergenic
1058612403 9:106790453-106790475 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1059546157 9:115178074-115178096 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1059574622 9:115475615-115475637 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1059606706 9:115842659-115842681 GCAAGTGTAGCAAGCTCCTGTGG + Intergenic
1059863485 9:118489128-118489150 GCAAGTGTAGCAAGCTCCTGTGG + Intergenic
1060318467 9:122534088-122534110 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1060737882 9:126078082-126078104 GCACTTGTAGCAAGCGCCTGGGG + Intergenic
1061583068 9:131549342-131549364 ACACTCGTAGCAAGCTCCTGGGG - Intergenic
1203492331 Un_GL000224v1:118968-118990 GCTCCTGCAGCAACCTCCTGGGG - Intergenic
1203504954 Un_KI270741v1:60840-60862 GCTCCTGCAGCAACCTCCTGGGG - Intergenic
1185858428 X:3556578-3556600 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1185960686 X:4543938-4543960 GCACTTGTAGCAAGCTCCTGTGG + Intergenic
1185991062 X:4893848-4893870 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1186112863 X:6275632-6275654 ACACTTGTAGCAAGCTCCTGGGG + Intergenic
1186607515 X:11107466-11107488 GCATTTCTAACAAGCTCCCGAGG + Intergenic
1186683147 X:11896908-11896930 GCATTTCTAGCAAGCTCCCAGGG + Intergenic
1186784069 X:12942079-12942101 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1187086521 X:16048141-16048163 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1187099956 X:16182611-16182633 GCACTTTTAGCAAGCTCCTGGGG + Intergenic
1187103766 X:16220275-16220297 GCACTTAAAGCAAGCTCCTGGGG + Intergenic
1187554064 X:20334271-20334293 GCACTTCTAACAAGCTCCTAGGG + Intergenic
1187958590 X:24545417-24545439 GCATTTGTAGGTAGATCCTGGGG + Intergenic
1188200966 X:27292597-27292619 GCACTAGAAGCAAGATCCTGAGG + Intergenic
1188333018 X:28896044-28896066 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1188419488 X:29977534-29977556 GCACTTGTAGCAAGCTCCTAGGG - Intergenic
1188431027 X:30105600-30105622 GCACTTGTAGCAAGCTCCTAGGG - Intergenic
1188463372 X:30452548-30452570 GCACTTGTGGCAAGCTCCTTTGG + Intergenic
1188552653 X:31379761-31379783 GCACTTGTAGCAAGCTCCTGGGG - Intronic
1188650111 X:32621848-32621870 GCACTTCTAGCAAGTTTCTAGGG - Intronic
1191014194 X:55791760-55791782 GCGCTTGAAGCAAGATCCTGGGG + Intergenic
1191805806 X:65133087-65133109 GCACTTGAAGCAAGATCCTCGGG + Intergenic
1191825554 X:65361974-65361996 GCACTTGAAGCAAGATCCTAGGG - Intergenic
1192454598 X:71266439-71266461 GCACATGAAGCAAGATTCTGGGG - Intergenic
1192706144 X:73529922-73529944 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1192914129 X:75635719-75635741 GCACTAGAAGCAAGATCCTGTGG + Intergenic
1193537095 X:82729117-82729139 GCACTTGAAGCAAAATCCTGGGG - Intergenic
1193885930 X:86984062-86984084 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1193941500 X:87684146-87684168 GCACGTGTAGCAAGCTCCTGAGG - Intergenic
1194186247 X:90776771-90776793 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1194293624 X:92103689-92103711 GCATGTGTAACAAGTTCCTGGGG + Intronic
1194308539 X:92276512-92276534 GCACTTGTAGCAAGCTCCTGGGG + Intronic
1194351291 X:92826748-92826770 GCACGTGTAGCAAGCTCCTAGGG - Intergenic
1194367108 X:93025190-93025212 GCACTTGTAGCAAGCTCCTCGGG - Intergenic
1194502980 X:94702272-94702294 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1194660690 X:96626283-96626305 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1194822766 X:98527724-98527746 GCAAGTGTAGCAAGCTCCTGTGG + Intergenic
1194873798 X:99162890-99162912 GCACTTATAGCAAGCTCCTGGGG + Intergenic
1195016952 X:100789873-100789895 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1195227648 X:102814685-102814707 GCAATTTTAGCAAGCAACTGTGG - Intergenic
1195291154 X:103432982-103433004 GCACTTGAAGCAAGTTCCTGGGG + Intergenic
1195570360 X:106393229-106393251 GCAATTGCAGCATGCTCCAGAGG - Intergenic
1195841487 X:109180678-109180700 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1195908676 X:109868668-109868690 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1196073084 X:111546174-111546196 GCACATGTAGCAAGCTCCTGTGG - Intergenic
1196165546 X:112532873-112532895 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1196220984 X:113112171-113112193 GCACTTGTGGCAAGCTCCTGGGG + Intergenic
1196227216 X:113180253-113180275 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1196300013 X:114042240-114042262 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1196330826 X:114469020-114469042 GCACGTGTAGCAAGCTCCTGTGG - Intergenic
1196341714 X:114604755-114604777 GCACGTGTAGCAAGCTCCTGTGG + Intronic
1196469907 X:116012930-116012952 GCACTTACAGCAAGATCCTGAGG - Intergenic
1196496866 X:116333080-116333102 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1196533539 X:116815917-116815939 GCATGTGTAGCAAGTTCCTGGGG + Intergenic
1196572500 X:117281416-117281438 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1196773852 X:119321218-119321240 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1196992684 X:121346442-121346464 GCACTTGTGGCAAGCTCCTGGGG + Intergenic
1197064918 X:122224292-122224314 GCACTTATAGCAAGCTCCTCGGG - Intergenic
1197352057 X:125392298-125392320 GCATGTGTAGCAAGCTCCTGGGG + Intergenic
1197470964 X:126865360-126865382 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1197933084 X:131714329-131714351 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1198599398 X:138267762-138267784 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1198965925 X:142228807-142228829 GCACTTGTAGCAAGCTCCTGGGG - Intergenic
1199576483 X:149317923-149317945 ACACTTGTAGCAAGTTCCTCGGG - Intergenic
1200532837 Y:4358850-4358872 GCACTTGTAGCAAGCTCCTGGGG + Intergenic
1200611142 Y:5328235-5328257 GCATGTGTAACAAGTTCCTGGGG + Intronic
1200659616 Y:5943438-5943460 GCACGTGTAGCAAGCTCCTAGGG - Intergenic
1200675322 Y:6141446-6141468 GCACTTGTAGCAAGCTCCTCAGG - Intergenic
1201061659 Y:10051775-10051797 ACACTTGAAGTAAGATCCTGGGG + Intergenic
1201307504 Y:12563381-12563403 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1201473504 Y:14357849-14357871 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1201540634 Y:15101692-15101714 GCACTTGAAGCAAGATCCTGGGG + Intergenic
1201581392 Y:15514632-15514654 GCATTTGTAGCAAGCTCCTGGGG - Intergenic
1201602728 Y:15748734-15748756 GCAGTTGTAGCATCCTCCAGAGG - Intergenic