ID: 951888976

View in Genome Browser
Species Human (GRCh38)
Location 3:27551582-27551604
Sequence TTGTAGCAAGCTCCTGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 279, 1: 246, 2: 232, 3: 106, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888967_951888976 22 Left 951888967 3:27551537-27551559 CCTGGCTGTGGGTATTCCTTGGC No data
Right 951888976 3:27551582-27551604 TTGTAGCAAGCTCCTGGGGGAGG 0: 279
1: 246
2: 232
3: 106
4: 214
951888971_951888976 -8 Left 951888971 3:27551567-27551589 CCAGATCTCTGGCACTTGTAGCA No data
Right 951888976 3:27551582-27551604 TTGTAGCAAGCTCCTGGGGGAGG 0: 279
1: 246
2: 232
3: 106
4: 214
951888969_951888976 6 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888976 3:27551582-27551604 TTGTAGCAAGCTCCTGGGGGAGG 0: 279
1: 246
2: 232
3: 106
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951888976 Original CRISPR TTGTAGCAAGCTCCTGGGGG AGG Intergenic
900395446 1:2451507-2451529 TTGGAGCCAGTTCCTGGGGCTGG - Intronic
900722538 1:4186689-4186711 TTGCAGCCAGCTCCTGGGGGAGG + Intergenic
900840789 1:5047101-5047123 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
900847476 1:5115376-5115398 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
901056915 1:6452648-6452670 TTCTAGCCAGCTCCTGGGTGAGG + Intronic
901139014 1:7016011-7016033 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901165252 1:7216260-7216282 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
902050918 1:13563134-13563156 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
902477457 1:16695847-16695869 TTCTAGCCAGCTCCTGGGTGAGG - Intergenic
902776091 1:18675948-18675970 TTGGAGCCAGCTCCTGGTGCAGG - Intronic
902928763 1:19715834-19715856 TTGTAGGAAGCTCTTGGGGTAGG - Intronic
902970417 1:20044148-20044170 TTGAAGCAAGATCCTGATGGAGG + Intronic
903033810 1:20481617-20481639 GTGGAGCAGGCCCCTGGGGGAGG - Intergenic
903396024 1:23002404-23002426 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
904393961 1:30205646-30205668 TTGAAGCAAAATCCTGGGGGAGG - Intergenic
904711636 1:32434601-32434623 GTGTACCAAGCTCTTGGGGGAGG - Intergenic
905060518 1:35135787-35135809 TTCTAGCAAGCTCCTGGGGGAGG + Intergenic
905499782 1:38427335-38427357 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
906080923 1:43087762-43087784 TTGTAGCAAGCTCCTGGGAGAGG - Intergenic
906744520 1:48212446-48212468 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
906839785 1:49124450-49124472 ATGTAGCATGCTCGTGTGGGTGG - Intronic
907292635 1:53426550-53426572 TTGTAGCAAACTCCTGGGGGAGG - Intergenic
907293605 1:53434500-53434522 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
907503565 1:54901317-54901339 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
907521261 1:55024854-55024876 TTGTAGCAAACTCCTGGGGGAGG - Intergenic
908416818 1:63921330-63921352 TTCTAACAAGCTCATGGGGGTGG + Intronic
908461713 1:64353424-64353446 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
908591952 1:65645332-65645354 ATGTAGCAAGCTCCTATGGGAGG + Intergenic
908852406 1:68388519-68388541 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
909222658 1:72983289-72983311 GTGTAGCAGGATCCTGGAGGAGG + Intergenic
909223650 1:72991240-72991262 ATGTAGCAAGCTCCTGGGGGAGG + Intergenic
909551017 1:76898230-76898252 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
909729432 1:78874541-78874563 TTGAAGCAAGATCCTGATGGAGG - Intergenic
909776690 1:79492019-79492041 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
909788266 1:79642181-79642203 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
909792975 1:79699800-79699822 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
909909963 1:81247693-81247715 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
909978448 1:82070972-82070994 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
910049383 1:82957570-82957592 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
910144129 1:84058679-84058701 TTGTAGAGAGCTCCTGGGGGAGG + Intergenic
911071077 1:93832314-93832336 TTGAAGCAAGATCCTGGGGTAGG - Intronic
911510613 1:98804697-98804719 TTGTAACAAGCTCCTTGGGGAGG + Intergenic
911570403 1:99511891-99511913 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
911653998 1:100422379-100422401 TTGTAGAAAGCTTCTGTGTGTGG - Intronic
911759780 1:101601491-101601513 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
911966930 1:104382441-104382463 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
912296477 1:108475205-108475227 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
912813567 1:112811693-112811715 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
912815306 1:112823924-112823946 TCATAGCAAGCTCCTGGGGAAGG + Intergenic
913245136 1:116864386-116864408 TTGAAGCAAGATCCTGGGGTAGG - Intergenic
916267629 1:162906514-162906536 TTGTAGCAACCTTCTGAGGCAGG + Intergenic
916328861 1:163593275-163593297 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
916941795 1:169685121-169685143 TTGAAGCAAGATCCTGATGGAGG - Intronic
917749656 1:178042231-178042253 TTGAAGCAAGATCCTGGGGCAGG - Intergenic
918347119 1:183615901-183615923 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
918567669 1:185951756-185951778 GTGTAGCAAGCTCCTGGGGGAGG + Intronic
918714403 1:187768953-187768975 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
919476401 1:198037047-198037069 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
920427340 1:205888728-205888750 TTAAAGCAAGATCCTGGGGGAGG + Intergenic
920829403 1:209451189-209451211 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
920901528 1:210114269-210114291 TTAAAGCAAGATCCTGGGGGAGG + Intronic
921212423 1:212911759-212911781 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
921459777 1:215413400-215413422 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
921509261 1:216010260-216010282 TTGTAGCAAGCTCCTGGAGGAGG - Intronic
921520132 1:216147801-216147823 GTGTAGCAAGCTCCTGGGGGAGG - Intronic
921732971 1:218597249-218597271 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
922048416 1:221968209-221968231 TTGTAGCAAACTCCTGGGGGAGG - Intergenic
922049530 1:221976563-221976585 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
922154066 1:223027863-223027885 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
922363543 1:224843913-224843935 TTGAAGCAAGCTCCTGGGGGAGG + Intergenic
922598977 1:226835521-226835543 TTGAAGCAAGATCCTGGGGCAGG - Intergenic
922877085 1:228948489-228948511 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
922906399 1:229176673-229176695 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
922934825 1:229414638-229414660 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
923075208 1:230603483-230603505 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
923214191 1:231833667-231833689 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
923244755 1:232120432-232120454 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
923257270 1:232232661-232232683 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
923408620 1:233686892-233686914 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
923770734 1:236935711-236935733 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
923775895 1:236978219-236978241 TTGCAGCAAGCGGCTGGGCGTGG - Intergenic
923962787 1:239103624-239103646 TTGTAGCAAGCCTCTGGGGGAGG - Intergenic
924896178 1:248339687-248339709 TTATAGCAAGCTCCTGGGGGAGG + Intergenic
1063106406 10:2996438-2996460 TTGTAGCAAGCTCCTGGGGAAGG + Intergenic
1063363170 10:5473365-5473387 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1063509595 10:6633052-6633074 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1063527678 10:6800549-6800571 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1064663810 10:17630302-17630324 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1064886991 10:20122617-20122639 TTGTAGCAAGCTCCTGGGGAAGG + Intronic
1065437633 10:25718700-25718722 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1065443118 10:25772197-25772219 GTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1066103394 10:32137113-32137135 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1066437212 10:35405937-35405959 TTGAAGCAAGATCCTGGGGGAGG + Intronic
1067360406 10:45573466-45573488 CTGAAGCAAGTTCCTGGGGGAGG - Intronic
1068058345 10:52037222-52037244 ATGTAGCAAGCTCCTGTGGGAGG + Intronic
1068179654 10:53502493-53502515 GTGTAGCAAGCTTCTGTGGGAGG + Intergenic
1068230977 10:54169009-54169031 GTGTAGCAAGCTCCTGTGGGAGG - Intronic
1068360776 10:55973454-55973476 TTGAAATAAGATCCTGGGGGAGG - Intergenic
1068592340 10:58864475-58864497 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1069620364 10:69833809-69833831 TTGTAGTAAGCTCCTGCGGAGGG + Intronic
1070474930 10:76820823-76820845 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1071493846 10:86154426-86154448 TTGTATCACTCTCCTGGAGGTGG - Intronic
1071897729 10:90084498-90084520 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1071916204 10:90297259-90297281 GTGTAGCAAGTTCCTGGGGGAGG - Intergenic
1071961116 10:90809679-90809701 TTGTAGCAAGCTCCTGGCAGAGG - Intronic
1072011274 10:91304945-91304967 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1072580263 10:96734466-96734488 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1072884528 10:99261844-99261866 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1073014022 10:100383999-100384021 TTGAAGAAAGATCCTGGGGGAGG - Intergenic
1073683529 10:105729618-105729640 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1073709487 10:106021077-106021099 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1073933210 10:108600056-108600078 TTGAAGCAAGATGCTGGGAGAGG - Intergenic
1074535817 10:114328161-114328183 TTGGAGCAACCTCGTGGGTGTGG - Intronic
1074740782 10:116482907-116482929 TTGCAGCAAGCTCCTGGGGGAGG - Intergenic
1075248701 10:120847102-120847124 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1075340711 10:121644980-121645002 TTCTAACAAGCTCCCCGGGGAGG - Intergenic
1077589874 11:3483092-3483114 TTGTAGCAAGCTCCTGAGAGAGG + Intergenic
1077612187 11:3650189-3650211 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1077679064 11:4222703-4222725 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1077688500 11:4319344-4319366 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1077766380 11:5163742-5163764 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1077850793 11:6073295-6073317 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1078046121 11:7915619-7915641 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1079124703 11:17710080-17710102 ATGTAGCAAGATCCAGAGGGCGG - Intergenic
1079230516 11:18645283-18645305 TTGCAGCAAGCTCCTGGGGGAGG - Intergenic
1079447466 11:20570042-20570064 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1079672568 11:23187397-23187419 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1079727070 11:23890640-23890662 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1079847687 11:25490677-25490699 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1080027913 11:27632542-27632564 TTGTGGCAAGCTCCTGGGGGAGG + Intergenic
1080227360 11:29975662-29975684 TTGTAGCAAACTCGTGGGGGAGG - Intergenic
1081159708 11:39736659-39736681 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1081356809 11:42122829-42122851 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1082097203 11:48140493-48140515 TTGCAGCAAGGACCTGGGGATGG + Intronic
1082197758 11:49324891-49324913 TTGAAGCAAGATCCTGAGGGAGG + Intergenic
1083534413 11:63455163-63455185 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1084047172 11:66575872-66575894 TTGTAGCAAGCTCCTGGAGAAGG - Intergenic
1084232306 11:67761937-67761959 TTGTGGCAAGCTCCTGGGGGAGG - Intergenic
1084245594 11:67854866-67854888 TTGTAGCAAGCTCCTGGGAGAGG + Intergenic
1084355556 11:68635965-68635987 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1084613271 11:70217735-70217757 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1084827094 11:71739712-71739734 TTGTAGCAAGCTCCTGGGAGAGG - Intergenic
1085151793 11:74258214-74258236 TTCTAGCAAACTGCTGGGAGAGG - Intronic
1085529074 11:77181131-77181153 ATGGAGCAGGCTCCTGGAGGAGG + Intronic
1085627290 11:78083230-78083252 TTGAAGCAAGATCCTGAGGGAGG - Intergenic
1085988018 11:81808468-81808490 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1086005022 11:82027474-82027496 TTGTAACAAGCTCCTGGGGGAGG - Intergenic
1086125304 11:83343542-83343564 TTGTAGCAAGCTCTTGCAGGAGG + Intergenic
1086134832 11:83435039-83435061 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1086136266 11:83446361-83446383 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1086658062 11:89383236-89383258 TTGAAGCAAGATCCTGAGGGAGG - Intronic
1087099102 11:94347973-94347995 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1087099645 11:94351906-94351928 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1087196920 11:95311776-95311798 TTGTAGAGAGCTCCTGGGGGAGG - Intergenic
1087314678 11:96590178-96590200 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1087839538 11:102907537-102907559 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1088554964 11:111052446-111052468 TTGTAGCAAGCTCCTCGGGGAGG - Intergenic
1089349097 11:117811535-117811557 TTGTAGTAAGCTCCTGGGGGAGG - Intronic
1089471051 11:118720457-118720479 TTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1089867046 11:121641382-121641404 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1089953303 11:122549205-122549227 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1089987686 11:122829376-122829398 TTGTAGGAAGCTCCTGGGGGAGG - Intergenic
1090107596 11:123869056-123869078 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1090526805 11:127546190-127546212 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1090546486 11:127772534-127772556 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1090850593 11:130567821-130567843 ATGTAGCAAGCTCCTGGGGGAGG + Intergenic
1090871953 11:130756968-130756990 TTGTAGCAAGCTCCTGGAGGAGG + Intergenic
1090926934 11:131257947-131257969 TTGTAGCAAGCTCCTGGGGTAGG + Intergenic
1091183678 11:133629038-133629060 TGGTAGCAAGCTCCGGGGGGAGG - Intergenic
1091640967 12:2236958-2236980 TTGTAGTAATCTCATGGTGGTGG - Intronic
1091886520 12:4020784-4020806 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1092416174 12:8291997-8292019 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1092465946 12:8731433-8731455 TTTTAGCCAGTTCCTGGTGGTGG + Intronic
1092592751 12:9966525-9966547 TTTTAGCAAGCTCCTGGGGGAGG + Intronic
1092626744 12:10336387-10336409 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1092723716 12:11465628-11465650 ATGTAGCAAGCTCCTGTGGGAGG + Intronic
1092733181 12:11553633-11553655 TTGGAGGAAGCTCCTAGGGGAGG - Intergenic
1092739320 12:11613153-11613175 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1092789712 12:12060646-12060668 TTGTAGCAAGCTCCTCGGGGAGG - Intronic
1092924851 12:13263429-13263451 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1093024334 12:14232833-14232855 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1093071161 12:14708332-14708354 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1093268007 12:17025162-17025184 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1093321984 12:17723736-17723758 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1093358439 12:18197204-18197226 TTGTAGCAAGCTCCTGGGGAAGG - Intronic
1093578819 12:20765630-20765652 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1093584515 12:20820460-20820482 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1093812833 12:23509470-23509492 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1093951073 12:25165401-25165423 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1094042333 12:26131282-26131304 TTGTAGAAATCTCCTTAGGGAGG + Intronic
1094161265 12:27393412-27393434 TTCTAGCAAGCTCCCAGGTGTGG + Intronic
1094316049 12:29138460-29138482 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1095637656 12:44452050-44452072 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1095999023 12:48113590-48113612 TTGAAGCAAGATCCTGGGGGAGG + Intronic
1096685632 12:53286596-53286618 TTTTTGCAAGCTCCTGGGGCTGG + Exonic
1096907190 12:54946386-54946408 TTGAAACAAGATACTGGGGGAGG + Intergenic
1097398590 12:59104093-59104115 TTGTGGCAAGTTCCTGGGGGAGG - Intergenic
1097417051 12:59326677-59326699 GTGTAGCAAGCTCCTGTTGGAGG + Intergenic
1097592427 12:61589505-61589527 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1098173635 12:67770106-67770128 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1098402251 12:70087654-70087676 GCGTAGCAAGCTCCTGGGGGAGG - Intergenic
1098629062 12:72705603-72705625 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1098630029 12:72712352-72712374 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1098653825 12:73005422-73005444 TTGTAGCAGGCTCCTGGGGGAGG + Intergenic
1098919908 12:76293713-76293735 TTGAAGCAAGCTCCTTGGGGAGG - Intergenic
1099188717 12:79542113-79542135 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1099292099 12:80786535-80786557 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1099762589 12:86941053-86941075 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1099836096 12:87910849-87910871 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1099898726 12:88681419-88681441 GTGTGGCAAGGTCCTGGGGCTGG - Intergenic
1100561362 12:95751430-95751452 ATGTAGCAAGCTCCTGTGGGAGG - Intronic
1100940299 12:99717441-99717463 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1101278396 12:103226138-103226160 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1102116739 12:110408720-110408742 TTGAAGCAAGATCCTGGGGTAGG + Intergenic
1102463677 12:113115565-113115587 TTGCAGGAGGGTCCTGGGGGAGG - Intronic
1102838219 12:116088056-116088078 ATGCAGGAAGATCCTGGGGGAGG + Intronic
1104257608 12:127154046-127154068 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1105032218 12:132891962-132891984 TTGAAGCAAGATCCTGATGGAGG - Intronic
1105806835 13:23956628-23956650 TTGTGGCAAGCTATTGGTGGTGG + Intergenic
1106943446 13:34800897-34800919 TTGTAGCAAGCTTCTGTGGGAGG - Intergenic
1107075581 13:36318696-36318718 GTGTAGCAAGCTCCTGTGGGAGG - Intronic
1107220293 13:37972634-37972656 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1107683139 13:42870876-42870898 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1108202698 13:48058651-48058673 TTATAGCAAGCTCCTGGGGGAGG - Intronic
1108282062 13:48870581-48870603 TTGGAGCAAGATCCTGGGGCAGG + Intergenic
1108512998 13:51172121-51172143 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1108803869 13:54131149-54131171 TTGTAGCAAGCCCCTGGGGGAGG + Intergenic
1108814129 13:54269110-54269132 GTATAGCAAGCTCCTGTGGGAGG - Intergenic
1108913417 13:55581703-55581725 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1108919543 13:55658432-55658454 GTGTAGCAAGCTCCTATGGGAGG + Intergenic
1108947438 13:56042565-56042587 GTGTAGCAAGCTCATATGGGAGG - Intergenic
1108952945 13:56115876-56115898 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1109343584 13:61090610-61090632 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1109352920 13:61207041-61207063 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1109499296 13:63215377-63215399 TTATAGCAAGCTCCTAGGGGAGG - Intergenic
1109709664 13:66144795-66144817 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1109716740 13:66229839-66229861 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1110650481 13:77936778-77936800 TTGAAGCAAGATCCTGATGGAGG + Intergenic
1110765478 13:79276389-79276411 TTGTAGGAAGCTCCTGGGGGAGG - Intergenic
1110845344 13:80185926-80185948 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1110978493 13:81868428-81868450 TTGTAGCAAGCTTCTGGGGGAGG - Intergenic
1111302050 13:86360660-86360682 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1111362105 13:87189885-87189907 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1111458838 13:88516283-88516305 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1111630442 13:90841694-90841716 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1111631700 13:90852045-90852067 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1112236830 13:97644570-97644592 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1112786486 13:102957176-102957198 TTCTAACAAGCTCCTGGGTGAGG + Intergenic
1112889315 13:104211515-104211537 TTGTAGCAAGCTCTTGGGGGAGG + Intergenic
1113324339 13:109267601-109267623 TTGCAGCAAGCTCCTGGGGGAGG - Intergenic
1113569410 13:111343216-111343238 GTGTGGGAAGCTCCTGGGGAGGG + Intronic
1114221679 14:20702837-20702859 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1115088772 14:29549115-29549137 TTGTAGCAAGCGGGTGGGGCTGG + Intergenic
1115240599 14:31248801-31248823 TTGTAGCAAGCTCCTGGGGAAGG + Intergenic
1115904810 14:38193045-38193067 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1116179679 14:41518197-41518219 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1116490583 14:45498842-45498864 TTGTAGCAAGCTTCTGGGGAAGG + Intergenic
1116534776 14:46015862-46015884 TTGTAGAAAGCTCCTGGAGGAGG + Intergenic
1116573457 14:46546181-46546203 TTGTAGCAAGCTCTTGGGGGAGG - Intergenic
1116613516 14:47106435-47106457 ATGTAGCAAGCTCCTGTGGGAGG - Intronic
1116702403 14:48258840-48258862 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1116703289 14:48265832-48265854 TTGTAGCAAGCTCCTGGGGGGGG + Intergenic
1116952915 14:50895425-50895447 GTGTAGCAAGCTCCTGTGGGAGG - Intronic
1117174156 14:53130650-53130672 TTGAAGCAAGATCCTGGGGGAGG - Intronic
1117182094 14:53201274-53201296 TTGTGGGAAGGACCTGGGGGAGG + Intergenic
1117801186 14:59446310-59446332 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1117957909 14:61136880-61136902 TCGTAGCAAGCTCCTGCGGGAGG + Intergenic
1118413102 14:65502897-65502919 TTCTAACAAGCTCCCAGGGGAGG + Intronic
1118937251 14:70299260-70299282 TTGAAGCAAGATCCTGATGGAGG + Intergenic
1119022436 14:71126580-71126602 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
1119317204 14:73705745-73705767 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1120251391 14:82064539-82064561 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1120438049 14:84503663-84503685 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1120539556 14:85736431-85736453 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1120618258 14:86733603-86733625 TTGTTGCAAGCTCTTGGGGGAGG - Intergenic
1120659953 14:87238495-87238517 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1121193299 14:92048167-92048189 TTGAAGCAAGATCCTGGGGTAGG + Exonic
1121289419 14:92762122-92762144 TTGAAGCAAGATCCTGAGGGAGG - Intergenic
1121703653 14:95975202-95975224 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1122040999 14:98987453-98987475 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1122381321 14:101309129-101309151 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1123882491 15:24689037-24689059 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1124824546 15:33080949-33080971 TTGAAGCAAGCTCCGGGTGGGGG - Intronic
1125045779 15:35241024-35241046 GTGTAGCAAGCTCCTGTGGGAGG - Intronic
1125131514 15:36289099-36289121 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1125213215 15:37239653-37239675 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1125597119 15:40894280-40894302 CTGCAGCAGGATCCTGGGGGCGG + Intergenic
1125629223 15:41133762-41133784 TTGAAACAAGATCCTGGGGGAGG - Intergenic
1125849093 15:42886780-42886802 TTGAAGCAAGATCCTGGGGGAGG - Intronic
1126843750 15:52740841-52740863 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1126912403 15:53430290-53430312 TTGTAGGAAGCTCCTGGGGGAGG + Intergenic
1127895148 15:63291920-63291942 CTGCTGCAAGCTCCTGGGGTGGG - Intronic
1129259439 15:74356183-74356205 TTGAAGCAAGATCCTGGGGCAGG - Intronic
1129462502 15:75706621-75706643 TTAGAACAGGCTCCTGGGGGTGG + Intronic
1129722362 15:77884793-77884815 TTAGAACAGGCTCCTGGGGGTGG - Intergenic
1130097530 15:80867158-80867180 TTCTAACAAGCTCCCAGGGGAGG - Intronic
1130855117 15:87833521-87833543 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1130945942 15:88550959-88550981 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1131164873 15:90135092-90135114 TTGAAGCAAGGTCCTGATGGAGG - Intergenic
1131447751 15:92513765-92513787 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1131538153 15:93254421-93254443 TTCTAACAAGCTCCCAGGGGAGG + Intergenic
1131684183 15:94753028-94753050 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1131882514 15:96875282-96875304 GTGTAGCAAGCTCCTTGGGGAGG + Intergenic
1132263017 15:100442541-100442563 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1132340415 15:101074791-101074813 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1133651397 16:7816958-7816980 TTGTAGCAAGCGCCTAGGGCAGG - Intergenic
1133765734 16:8836471-8836493 GTGTAGCAAGCTCCTGGGGGAGG + Intronic
1133766761 16:8843538-8843560 GTGTAGCAAGCTCCTGGGGGAGG + Intronic
1133869541 16:9674571-9674593 TTGTAGCAATCTCCTGGGGGAGG + Intronic
1133938178 16:10285409-10285431 TTGAAGCAAGCTCCTGGGGGAGG - Intergenic
1134342176 16:13356026-13356048 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1135025412 16:18995587-18995609 TTAGAGCAAGATCCTGGGGGAGG + Intronic
1135819338 16:25667377-25667399 CTGTAGCTAGCTACTTGGGGAGG + Intergenic
1135851678 16:25969441-25969463 TTGTACAGAGCTCGTGGGGGTGG + Intronic
1136365875 16:29809076-29809098 TTGTCTCCAGCTCCTGGGGCAGG + Intronic
1136455203 16:30376374-30376396 CTGGAGCAGGCTCCTGGGGCCGG - Intronic
1136529953 16:30861411-30861433 TTGAAGCAAGATCCTGGGGGAGG - Intronic
1137840703 16:51638278-51638300 TTGTAACAATTTCCAGGGGGTGG - Intergenic
1138759099 16:59521086-59521108 TTGTAGCAAGCTCCTGGGGAAGG + Intergenic
1138804952 16:60081087-60081109 GTGTAGCAAGCTCCTAGGGGAGG - Intergenic
1139039234 16:62982601-62982623 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1139225913 16:65233290-65233312 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1139230598 16:65278707-65278729 GTGTAGCAAGCTCCTGGGGAAGG + Intergenic
1139943048 16:70619922-70619944 ATGTAGCAAGCTCCTGTGGGAGG + Intronic
1139943718 16:70624239-70624261 GTGTAGCAAGCTCCTGGGGAAGG + Intronic
1141288286 16:82693050-82693072 ATGTAGCAAGGAGCTGGGGGTGG + Intronic
1141468737 16:84224085-84224107 TTCTAACAAGCTCCTCGGGGAGG - Intronic
1141865201 16:86745479-86745501 TTGTAGCAAGGTCCTTGGGGAGG + Intergenic
1142234108 16:88913339-88913361 TTTTGGCAAGCTCAGGGGGGTGG - Intronic
1143414343 17:6735060-6735082 TTGTAGCAAGCTCCTGAGGGAGG + Intergenic
1143970197 17:10789818-10789840 TTCTAACAAGCTCCTAGGGGAGG + Intergenic
1144104674 17:11974150-11974172 TTGTAGTAAGCTCCTGGGGGAGG - Intergenic
1145080663 17:19891917-19891939 TTGAAGCAAGATCCTGGGAGAGG + Intergenic
1145974064 17:28974228-28974250 CTGTAGCCAGCATCTGGGGGTGG - Intronic
1146597899 17:34185529-34185551 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1146887554 17:36482826-36482848 TTGCGGACAGCTCCTGGGGGCGG - Intergenic
1149319570 17:55470054-55470076 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1149598138 17:57875960-57875982 TTGAAGCATGCTCCCCGGGGTGG + Intronic
1151622491 17:75254829-75254851 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1151839753 17:76609409-76609431 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1155028301 18:21962101-21962123 TTGTAACAAGCTCCCAGGTGAGG + Intergenic
1155173821 18:23286295-23286317 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1155697014 18:28696555-28696577 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1155941550 18:31806060-31806082 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1155945918 18:31851372-31851394 TTGTTACAAGCTCCTAGGTGAGG - Intronic
1156237362 18:35218024-35218046 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1156251929 18:35359763-35359785 TCGTAGCAAGCTCCTGGGGGAGG + Intergenic
1156302250 18:35846149-35846171 TTGTAGCGAGCTCCTGGGGGAGG - Intergenic
1156924051 18:42555945-42555967 TTGTAGCAAGCTCCAGGGGGAGG + Intergenic
1156938533 18:42738907-42738929 TTGTAGCAAGCTCCAGGGGGAGG - Intergenic
1156958181 18:42993129-42993151 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1157906389 18:51573493-51573515 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1158235535 18:55308931-55308953 TTGTAGAAAGTTCCATGGGGAGG - Intronic
1158336379 18:56417846-56417868 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1158394642 18:57070081-57070103 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1158576694 18:58644436-58644458 TTGAAGCAAGCTCCTGGGGGAGG + Intergenic
1159164469 18:64683896-64683918 TTGTAGCAAGTTCCTGGGGGAGG - Intergenic
1159835054 18:73326892-73326914 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1159929220 18:74294688-74294710 TTGAAGCAAGATCCTGGGGTAGG - Intergenic
1160179837 18:76624530-76624552 TTTTAGCAAGCTCCCAGGTGAGG - Intergenic
1160732111 19:645999-646021 GTGCAGCAGGCTCCTGGGGCAGG + Intergenic
1161661720 19:5550726-5550748 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1161711218 19:5849345-5849367 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1161712042 19:5854365-5854387 TTGAAGCAAGATCCTGGGGCAGG - Intergenic
1162331324 19:10031505-10031527 TTGAAGCAAGGTCCTGGAGCGGG + Intergenic
1163487292 19:17595684-17595706 TTGTAGCAAGCTCCTGGTGGAGG - Intergenic
1163900219 19:20094079-20094101 TTGAAGCAAGATCCTGATGGAGG + Intronic
1163907186 19:20157788-20157810 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1163944449 19:20522535-20522557 TTGAAGCAAGATCCTGAGGGAGG + Intergenic
1164080810 19:21860057-21860079 TTGAAGCAAGATGCTGGGGAAGG - Intergenic
1164152974 19:22570496-22570518 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1164202502 19:23030275-23030297 TTGAAGTAAGATCCTGGGGGAGG + Intergenic
1164459228 19:28433317-28433339 TTGTAGCAAGCTTCTGGGGGAGG + Intergenic
1165249240 19:34516249-34516271 TTGAAGCAAGCTCCTGGGGCAGG - Intergenic
1165385664 19:35509409-35509431 TGCTAACAAGCTCCTGGGTGAGG - Intronic
1165497003 19:36158872-36158894 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1165510316 19:36262938-36262960 TTATAGCAAGCTCCTGGGGGAGG + Intergenic
1165835360 19:38751866-38751888 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1166498939 19:43326957-43326979 GTGTAGCAAGCGCCTGGGGGAGG + Intergenic
1166905791 19:46107504-46107526 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1166927139 19:46276780-46276802 TTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1167046601 19:47053202-47053224 GTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1167099461 19:47395302-47395324 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1167220554 19:48195929-48195951 TTGAAGGAAGCCCCTGGAGGGGG + Intronic
1167504778 19:49865463-49865485 TTGGAGGAAGCTCCCGGTGGGGG - Intronic
1167640046 19:50676353-50676375 TTTGAGCAAACTCCTGGAGGAGG + Intronic
1167901105 19:52623004-52623026 TTGAAGCAAGATCCTGAGAGAGG - Intronic
1167902151 19:52630027-52630049 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1168227984 19:55010238-55010260 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1168248145 19:55124796-55124818 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1202711477 1_KI270714v1_random:21673-21695 TTCTAGCCAGCTCCTGGGTGAGG - Intergenic
925123272 2:1436359-1436381 TTGTTGCAAGCTCCTGTGATGGG - Exonic
925544555 2:5003235-5003257 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
925828817 2:7876116-7876138 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
926413592 2:12628757-12628779 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
926464090 2:13167445-13167467 GTGTAGCAAGCTCCTGGGGAAGG + Intergenic
926815545 2:16795396-16795418 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
928770178 2:34696108-34696130 TTGTAGCAAGCTCTTGGGGGAGG - Intergenic
928778306 2:34791963-34791985 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
928827654 2:35440552-35440574 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
928857172 2:35815336-35815358 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
928928565 2:36601291-36601313 TTGTAGTAAGCTCCTGGGGGAGG - Intronic
929004831 2:37384425-37384447 TTGTAGCAAGCTCTTGTGGGAGG + Intergenic
929076672 2:38084220-38084242 TTGTAGCAAGCTCCTAGGGGAGG + Intronic
929383541 2:41380189-41380211 TTGAAGCAAGATCCTGAGGGAGG - Intergenic
929684527 2:44022498-44022520 TGGAAGCAAGATCCTGGGGGAGG + Intergenic
929793063 2:45037890-45037912 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
930099078 2:47589122-47589144 TTGAAGCAACATCCTGGGGGAGG + Intergenic
930487362 2:52025568-52025590 TTGTAGCAAGCTCCTAGGGGAGG + Intergenic
930955100 2:57195222-57195244 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
930958382 2:57231144-57231166 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
931026391 2:58116870-58116892 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
931042616 2:58315952-58315974 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
931236943 2:60419867-60419889 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
931608924 2:64078624-64078646 TTGTGGCAAGCTCCTGGGGGAGG + Intergenic
931625778 2:64254784-64254806 ATGTAGCAAGCTCATGGGGGAGG - Intergenic
931850426 2:66246187-66246209 TTGTAGCAAGCTCCTTGGGGAGG - Intergenic
931948259 2:67333853-67333875 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
932159458 2:69447106-69447128 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
932295855 2:70622883-70622905 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
932367646 2:71163138-71163160 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
932751594 2:74374863-74374885 TTGGAGCACGCTCTTGGGGGTGG - Intronic
932854209 2:75217247-75217269 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
933013093 2:77090632-77090654 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
933079273 2:77967365-77967387 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
933137936 2:78760154-78760176 TTGAGGCAAGATCCTGGTGGAGG - Intergenic
933163733 2:79053643-79053665 TTGTAGCAAGCTCCTGGGGAGGG - Intergenic
933179765 2:79215273-79215295 TTGTAGCAAGCTCCTGGGAGAGG + Intronic
933329519 2:80877921-80877943 ATGTAGCAAGCTCCTGGGGGAGG + Intergenic
933552392 2:83792364-83792386 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
934141264 2:89050175-89050197 TTGAAGCAAGATCCCGGGGGAGG - Intergenic
934227976 2:90150369-90150391 TTGAAGCAAGATCCCAGGGGAGG + Intergenic
936794292 2:116187723-116187745 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
936870794 2:117132575-117132597 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
936883336 2:117280997-117281019 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
939083137 2:137686398-137686420 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
939307414 2:140428395-140428417 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
939348549 2:141001113-141001135 TTGTAGGAAGTTACAGGGGGAGG - Intronic
939460732 2:142493287-142493309 TTGAAGCAAGTTCCTGGGGGAGG + Intergenic
940107350 2:150114866-150114888 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
940182941 2:150955295-150955317 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
940530190 2:154869577-154869599 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
940675801 2:156723523-156723545 TTGTAGCAAGCTCCTGGGGAAGG + Intergenic
940726437 2:157341557-157341579 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
941340401 2:164298111-164298133 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
941353387 2:164461366-164461388 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
941456187 2:165713950-165713972 GTGTAGCAAGTTCCTGGGGGAGG + Intergenic
941935889 2:170981093-170981115 TTGTAGCAAGCTTCTGGGGGAGG + Intergenic
942097087 2:172543994-172544016 TTGTAGCAAGCTTCTGGGGGAGG - Intergenic
942730290 2:179055210-179055232 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
943412930 2:187563933-187563955 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
943421583 2:187673932-187673954 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
943461191 2:188172659-188172681 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
943835404 2:192509736-192509758 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
943951286 2:194134333-194134355 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
944387451 2:199181628-199181650 CTGAAGCAAGCTCCTGGGGGAGG - Intergenic
944394141 2:199249181-199249203 GTGTAGCCAGCTCCTGGGGGAGG - Intergenic
944876130 2:203965371-203965393 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
944879136 2:203993581-203993603 ATCTTGCAAGCTCCTTGGGGTGG + Intergenic
944936926 2:204579246-204579268 TTGCAGCAATCTCATGGGGTTGG + Intronic
945153102 2:206810312-206810334 ATTTAGCAAGCTCCTGGGGGAGG + Intergenic
945257537 2:207814671-207814693 ATGCAGCAAGCTCCTGAAGGAGG + Intergenic
945301483 2:208219691-208219713 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
945361650 2:208901496-208901518 TTGTAGGAAGCTCCTGGGGGAGG - Intergenic
945376102 2:209080327-209080349 TTGTAGCAAGCTTCTGGGGGTGG - Intergenic
945394302 2:209301479-209301501 GTGTAGCAAGTTCCTGGGGGAGG - Intergenic
945858120 2:215091844-215091866 TTGAAGCAAGATCCTGGGGGAGG - Intronic
945938319 2:215924627-215924649 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
946215029 2:218177486-218177508 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
946781043 2:223193295-223193317 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
946816081 2:223579932-223579954 GTGTAACAAGCTCCTGGATGAGG - Intergenic
946886501 2:224227546-224227568 TTGTAGCAAGCTCCTGGGAGAGG - Intergenic
946893275 2:224298931-224298953 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
946932295 2:224682306-224682328 TTGTAGCATACCCCTGGGGCTGG - Intergenic
947474443 2:230430523-230430545 TTGTAGCAAGGACCTAAGGGAGG - Intronic
948323276 2:237088922-237088944 ATGAAGGAAGCTCCTGGAGGTGG + Intronic
948390686 2:237609211-237609233 TTGTAGCAAGTTCCTGGGGGAGG - Intergenic
1168839267 20:898799-898821 TTGAAGCAAGATCCTGTGGGAGG - Intronic
1168943278 20:1731197-1731219 TTAAAGCAAGATCCTGGGGGAGG + Intergenic
1170068863 20:12343730-12343752 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1170106236 20:12756128-12756150 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1170165743 20:13359217-13359239 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1170325486 20:15151288-15151310 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1170680432 20:18521052-18521074 TTGAAGCAAGCTCCTGCGGGAGG + Intronic
1170820700 20:19754600-19754622 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1170876343 20:20253866-20253888 TTCTAACAAGCTCCCGGGTGAGG + Intronic
1171445615 20:25201835-25201857 TAGTCCCAAGCTCCTTGGGGAGG - Intronic
1172111349 20:32547155-32547177 TTGTCCCAACCTCCTGGGGCTGG - Intronic
1172932468 20:38596171-38596193 TTGAAGCAAGATCCTGATGGAGG + Intergenic
1173101913 20:40095604-40095626 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1173118873 20:40271314-40271336 TTGTAGCAATTTCCTGGGGGAGG - Intergenic
1173394580 20:42667327-42667349 TTGCAGCAAGCTTGTGAGGGAGG - Intronic
1173781728 20:45762049-45762071 TTGAAGCAAGATCCTGATGGAGG - Intronic
1176172713 20:63703416-63703438 CTGTGGGAAGTTCCTGGGGGTGG - Intronic
1176306521 21:5126373-5126395 TTGCAGCAAGCAACTGGAGGAGG - Intronic
1177031171 21:15983246-15983268 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1177063012 21:16396789-16396811 GTGGAGCAACATCCTGGGGGAGG + Intergenic
1177100625 21:16894432-16894454 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1177102675 21:16916244-16916266 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1177119567 21:17123749-17123771 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1177840743 21:26231494-26231516 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1178001202 21:28163470-28163492 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1178601408 21:33997918-33997940 TTCTAGCAAGCTCCCAGGTGAGG - Intergenic
1179015280 21:37590465-37590487 TTGTAGCATGCTCCCGGGGGAGG + Intergenic
1179387558 21:40957206-40957228 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1179650365 21:42804481-42804503 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1179850538 21:44135657-44135679 TTGCAGCAAGCAACTGGAGGAGG + Intronic
1182017616 22:27053906-27053928 TTGGAGCCAGGTCCTGGGGTGGG + Intergenic
1182113951 22:27744239-27744261 AGGTAGCAAGCTCCTGTGGGAGG - Intergenic
1182732276 22:32505033-32505055 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1182998606 22:34836569-34836591 TTGTAGCAAGCTCTTGGAGGAGG - Intergenic
1183635669 22:39060970-39060992 TTGAAGCAAGATCCTGGGGAAGG + Intronic
1183696499 22:39426693-39426715 TCGCAGCAATCTCCTGGGGGAGG - Exonic
1184398506 22:44259998-44260020 TTGAAGTAATCTCCTGGTGGGGG - Intronic
949162091 3:894123-894145 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
949190394 3:1243266-1243288 TTGTAGCAAGCTCCTGGGGAAGG + Intronic
949671155 3:6399935-6399957 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
949770786 3:7575193-7575215 TAGTAGGTAGCTCCTGGGGAAGG - Intronic
949827443 3:8179272-8179294 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
950263301 3:11557420-11557442 TTGTTACAAGCTCCCAGGGGAGG - Exonic
951298809 3:20970966-20970988 TTGTAGCAACCTCCTTGGGGAGG + Intergenic
951332326 3:21382017-21382039 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
951762794 3:26163824-26163846 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
951888976 3:27551582-27551604 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
952343560 3:32464864-32464886 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
952663456 3:35877779-35877801 TTGTAGAAAGCTCCTGGGGGAGG + Intergenic
952896055 3:38079734-38079756 TCGTAGCAAGCTCCTGGGGGAGG + Intronic
953077133 3:39581254-39581276 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
953177193 3:40563235-40563257 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
953599439 3:44348477-44348499 TTGAAGCAAGATCCTGGGGGAGG + Intronic
953656564 3:44859138-44859160 TTTAAGCAAGCTCCTGTGGGAGG + Intronic
953825699 3:46249745-46249767 TTGTAGCAAGCTCCTCGGGGAGG + Intronic
953841163 3:46391192-46391214 TTGAAGGAAGATCCTGGGGGAGG + Intergenic
954161764 3:48727783-48727805 TTGAAGCAAGATCCTGATGGAGG + Intronic
954969267 3:54637937-54637959 GTGTAGCAAGTTCCTGGGGGAGG + Intronic
955253366 3:57305934-57305956 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
956233499 3:67042134-67042156 CTGAAGTAAGATCCTGGGGGAGG + Intergenic
956548988 3:70438317-70438339 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
956709218 3:72025244-72025266 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
957059899 3:75473486-75473508 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
957155115 3:76536106-76536128 TTGAGGCAAGGTCCTGGGAGAGG + Intronic
957181154 3:76879365-76879387 TTCTAACAAGCTCCCGGGAGAGG + Intronic
957295235 3:78326058-78326080 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
957317312 3:78586601-78586623 ATGTAGCAAGCTCCTGGGGGAGG + Intergenic
957394368 3:79620069-79620091 TTGAAGCAAGATCTTGAGGGAGG - Intronic
957451438 3:80387136-80387158 TTGAAGCAAGATCCTTTGGGTGG - Intergenic
957675251 3:83356575-83356597 TTGAAGTAAGATCCTGGGGGAGG + Intergenic
957869868 3:86077582-86077604 TTGTAGCATGCTACTGTTGGTGG + Intergenic
957904844 3:86541836-86541858 TTGAAGTAAGATCCTGCGGGAGG + Intergenic
957985689 3:87571612-87571634 TTGAAGCAAGATCCTGGGGAAGG - Intergenic
958421955 3:93940056-93940078 TTGAAGCAAGATCCTGGGGGAGG - Intronic
958676811 3:97276439-97276461 TTGTAGCAAGCTCCTGGGAGAGG + Intronic
958751002 3:98193255-98193277 TTGAAGTAAGATCCTGGGAGAGG - Intronic
959288351 3:104443373-104443395 GTGTAGCAAGCTCTTGGGGGAGG + Intergenic
959485774 3:106926184-106926206 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
959543695 3:107570096-107570118 TTGAAGCAAGATCCTGGGGCGGG + Intronic
959972267 3:112421019-112421041 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
960282877 3:115796960-115796982 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
960310114 3:116108773-116108795 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
961164762 3:124756007-124756029 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
961293510 3:125865959-125865981 TAGTAGCAAGCTCCTGGGGGAGG - Intergenic
961552207 3:127675960-127675982 TCGCAGCGGGCTCCTGGGGGAGG - Exonic
961711625 3:128832646-128832668 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
961730587 3:128961961-128961983 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
961893712 3:130150594-130150616 TTGTAGCAAGCTTCTGGGAGAGG + Intergenic
962022187 3:131512562-131512584 TTAAAGCAAGATCCTGGGGGAGG + Intergenic
962205566 3:133431384-133431406 TTGAAGCAAGCTCCTGGGGGAGG - Intronic
962660632 3:137597729-137597751 CTTTAGCAAGCTCCTGGGGGAGG - Intergenic
963058623 3:141207219-141207241 TTGTAGGAAGCTCCTGGGGGAGG - Intergenic
963111840 3:141694741-141694763 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
963319748 3:143799538-143799560 TTGTAGCAAGCTCCTGGATGAGG - Intronic
963425217 3:145115235-145115257 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
963456661 3:145554630-145554652 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
963468614 3:145712653-145712675 TTGTAGCAAGCTCCTAGGGGAGG - Intergenic
963520449 3:146355803-146355825 TTGTAGCAAGCTCCTAGGGGAGG - Intergenic
963521624 3:146364308-146364330 TTGTAGCAAACTCCTGGGGGAGG - Intergenic
963663344 3:148153906-148153928 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
963684331 3:148416603-148416625 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
964067874 3:152599595-152599617 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
964067898 3:152599698-152599720 TTGTAGCAAGCTCCTGGGGTAGG - Intergenic
964125453 3:153230148-153230170 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
964300253 3:155278637-155278659 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
964906513 3:161725316-161725338 TTGTAGCAAGCTTCTAGGGGAGG + Intergenic
964940956 3:162157594-162157616 TTGTAGCAAGCTCCTGGGAGAGG + Intergenic
964983635 3:162714657-162714679 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
964984871 3:162725978-162726000 TTGTAGCAAGCTACTGGGGGAGG + Intergenic
965070329 3:163909798-163909820 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
965105229 3:164345574-164345596 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
965262652 3:166504240-166504262 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
965286732 3:166827558-166827580 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
965335104 3:167424847-167424869 TTGAAGCAAGATCCTGATGGAGG - Intergenic
965336328 3:167433470-167433492 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
965624881 3:170675977-170675999 TTATAGCAAGCTCCTGGGGAAGG + Intronic
965626310 3:170686779-170686801 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
965640039 3:170821413-170821435 TTATAGCAAGCTCCTGGGGAAGG + Intronic
965713408 3:171578669-171578691 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
965861970 3:173159363-173159385 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
966085431 3:176063590-176063612 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
966105085 3:176325078-176325100 TTGCAGCAAGCTCCTGGGGGAGG + Intergenic
966232848 3:177669294-177669316 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
966279303 3:178209787-178209809 TTGTAGGAAGCTCCTGGGGGAGG - Intergenic
966397655 3:179519117-179519139 TTGTAGCAAGCTCCTGGGAGAGG - Intergenic
966398448 3:179524388-179524410 TTGAAGCAAGATCCTGATGGAGG + Intergenic
967005362 3:185377987-185378009 TTGTAGCAAGCTCCTGGGGTGGG + Intronic
967212166 3:187178984-187179006 GTGTAGCAAGCTCCTGTGGGAGG + Intronic
967244167 3:187469726-187469748 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
967496221 3:190146760-190146782 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
967561384 3:190922360-190922382 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
967658106 3:192074540-192074562 TTGTAGCAAGCTCCTGGGGAAGG + Intergenic
967740485 3:192997938-192997960 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
969003812 4:4003671-4003693 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
969654099 4:8486237-8486259 TTGTAGCAAGCTCCTGGGGAAGG + Intronic
969723380 4:8905676-8905698 TTATGGCAAACTCCTGGGGGTGG + Intergenic
969749055 4:9096514-9096536 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
969810115 4:9641154-9641176 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
970029234 4:11657188-11657210 ATGTAGCAAGCTCCTGGGGGAGG + Intergenic
970042090 4:11808528-11808550 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
970532735 4:16999917-16999939 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
970854047 4:20633754-20633776 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
971123184 4:23725481-23725503 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
971180563 4:24325465-24325487 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
971200140 4:24503262-24503284 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
971552650 4:27976219-27976241 TTGAAGCAAGATCCTGGGGTAGG - Intergenic
972070814 4:35018212-35018234 TTGAAGCAAGATCCTAGGGGAGG + Intergenic
972071138 4:35020241-35020263 TTGAAACAAAATCCTGGGGGAGG + Intergenic
973808746 4:54549978-54550000 TTCTAACAAGCTCCCTGGGGTGG + Intergenic
974428399 4:61767747-61767769 GTGTAGCAAGTTCCTGGGGGAGG + Intronic
975865089 4:78717317-78717339 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
975933888 4:79557436-79557458 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
976558570 4:86476842-86476864 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
976696537 4:87924120-87924142 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
976739958 4:88347206-88347228 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
976884572 4:89968251-89968273 TTGTAGCAAGCTCCTCGGGGAGG + Intergenic
977012925 4:91658081-91658103 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
977062509 4:92274949-92274971 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
977075206 4:92442420-92442442 GTGTAGCAAGCTCCTTGGGGAGG + Intronic
977122172 4:93115845-93115867 TTGTAGGAGGGACCTGGGGGAGG - Intronic
977198428 4:94088083-94088105 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
977217155 4:94296674-94296696 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
977225343 4:94386927-94386949 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
977446439 4:97138060-97138082 TTGAAATAAGATCCTGGGGGAGG + Intergenic
977492332 4:97731448-97731470 TTGCAGCATGCTCCTGGGTGAGG + Intronic
977782439 4:100995238-100995260 TTGAAGCAAGTTCCCGGGGGAGG + Intergenic
978001120 4:103557222-103557244 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
978031483 4:103943393-103943415 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
978303230 4:107293879-107293901 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
978438610 4:108711279-108711301 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
979054623 4:115979112-115979134 TTATAGGAAGCTCCTGGGGGAGG + Intergenic
979146619 4:117254352-117254374 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
979379941 4:119996173-119996195 ATGCAGCAAGCTCCTGTGGGAGG - Intergenic
979850308 4:125565095-125565117 ATGTAGCAAGCTCCTGTGCTAGG + Intergenic
979895158 4:126148595-126148617 TTGTAGCAAGCTCCTGGGGCAGG + Intergenic
980003353 4:127514905-127514927 TTGTAACAAGCTCCTGGGGGAGG + Intergenic
980111927 4:128644313-128644335 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
980284946 4:130769612-130769634 TTGTAGCAAGTTTCTGGGGGAGG - Intergenic
980388924 4:132120452-132120474 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
980472442 4:133267151-133267173 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
980527868 4:134014426-134014448 TTGTAGCAAGTTCCTGGGGGAGG - Intergenic
980575637 4:134681365-134681387 TTGTAGCAAGCTACTGGGGGAGG + Intergenic
980903937 4:138930123-138930145 TTGTAGCAAGCTACTGGGGGAGG - Intergenic
981040243 4:140215746-140215768 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
981482728 4:145255004-145255026 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
981525209 4:145701352-145701374 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
981539724 4:145834997-145835019 GTGTAGCAAGCTCCTGTGGGAGG - Intronic
981805355 4:148709170-148709192 TTGAAGCAATCTCCTGGTGCGGG - Intergenic
982083968 4:151816061-151816083 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
982094450 4:151909170-151909192 ATTTAGCAAGCTGCTGGGGATGG + Intergenic
982318809 4:154058532-154058554 TTGAAGCAAGATCCTGAGGGAGG - Intergenic
982396719 4:154922297-154922319 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
982414197 4:155111920-155111942 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
982497105 4:156106925-156106947 TTGTAGCAAGCTCCTGCAGGAGG + Intergenic
982535446 4:156602534-156602556 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
983055487 4:163095340-163095362 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
983345555 4:166522774-166522796 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
983360406 4:166718552-166718574 GTGTAGCAAGATCCTGTGGGAGG - Intergenic
983414709 4:167439263-167439285 GCGTAGCAAGCTCCTGTGGGAGG + Intergenic
983448059 4:167878522-167878544 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
983556271 4:169061884-169061906 TTGTGGCAAGTGCCTGAGGGAGG + Intergenic
983659571 4:170118706-170118728 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
983707673 4:170679744-170679766 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
983805789 4:171989489-171989511 TTGTAGCAAACTCCTGGGAGAGG + Intronic
983878254 4:172902487-172902509 TGTTGGCAAGCTCCTGGGGATGG - Intronic
983883757 4:172959828-172959850 TTGTAGCAAGCTCCTGGAGGAGG + Intronic
984099048 4:175464893-175464915 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
984165357 4:176298307-176298329 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
984322187 4:178209374-178209396 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
984393615 4:179168348-179168370 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
984411726 4:179405470-179405492 TGGAAGCAAGATCCTGGGGGAGG - Intergenic
984437263 4:179722698-179722720 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
984700671 4:182816774-182816796 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
985057397 4:186047656-186047678 TTGTAGCAAGCTCTTGGGGGAGG + Intergenic
985389870 4:189482922-189482944 GTGTAGCAAGCTCCTGGGGAAGG + Intergenic
985420747 4:189782954-189782976 TACCAGCAAGCTCCTGGAGGAGG + Intergenic
985435721 4:189928101-189928123 TTGTAGCAAGCTCCTAGTGGGGG - Intergenic
986193535 5:5517807-5517829 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
986388879 5:7265837-7265859 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
986502638 5:8416348-8416370 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
986555043 5:9002004-9002026 TTGCAGCAAGCTCCTGGGGGAGG + Intergenic
986905774 5:12492053-12492075 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
986919587 5:12665998-12666020 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
987282039 5:16422266-16422288 TTGTAGCAAGCTTCTGGGGGAGG - Intergenic
987486835 5:18535927-18535949 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
987487503 5:18540561-18540583 TTGTAGCAATCTCCTGTGGGAGG - Intergenic
987498123 5:18672317-18672339 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
987755831 5:22097096-22097118 TTGTAGCAAGCTCCTGAGGGAGG - Intronic
988199097 5:28047891-28047913 TTGGAGCAAGATCCTGGGGCAGG - Intergenic
988922257 5:35954246-35954268 TTGTGGGAAGCTGCTGGGTGTGG - Exonic
989107401 5:37876471-37876493 ATGTGGCAAGGTCCTGAGGGTGG + Intergenic
989475963 5:41872883-41872905 CTGTAGCCAGCTACTGGGGTGGG + Intergenic
989615158 5:43331397-43331419 TTGAAGCAAGATCCTTGAGGAGG + Intergenic
989688902 5:44118193-44118215 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
990565125 5:57020439-57020461 TTGAAGCAAGATCCTGCAGGAGG + Intergenic
991912828 5:71578487-71578509 TTCTAACAAGTTCCTGGGTGAGG + Intergenic
992394661 5:76359606-76359628 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
992452003 5:76883842-76883864 TTGTAGCAAGCTCCTGGGGAAGG + Intronic
992960829 5:81955510-81955532 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
993192712 5:84700731-84700753 GTGTAGCAAGCTCTTGTGGGAGG - Intergenic
993272635 5:85814855-85814877 TTGAAGTAATCTCCTGGTGGGGG - Intergenic
993836706 5:92826227-92826249 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
994126109 5:96170335-96170357 TTGTAGCAAGCTGCGGGAGGAGG + Intergenic
994295147 5:98081317-98081339 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
994324874 5:98436820-98436842 TTGAGGCAAGTACCTGGGGGAGG - Intergenic
994375787 5:99014766-99014788 TTGAAGGGAACTCCTGGGGGAGG + Intergenic
994532546 5:100987712-100987734 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
994556937 5:101317188-101317210 TTGTAGCAAGCTCCTCGGGGAGG - Intergenic
994775683 5:104033869-104033891 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
994778947 5:104067646-104067668 GTGTAGCAAGCTCCTGGGAGAGG + Intergenic
994989552 5:106980632-106980654 TTGTAGCAAGCTCATGGGGGAGG - Intergenic
995125162 5:108571915-108571937 TTGTAGCAAGCTCTTGGGGGAGG + Intergenic
995296675 5:110532093-110532115 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
995312553 5:110730740-110730762 TTGTAGGAGGGACCTGGGGGAGG - Intronic
995769382 5:115652783-115652805 TTGAAACAATCTCCTGGGGGAGG - Intergenic
995899366 5:117049823-117049845 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
996052676 5:118950666-118950688 TTGAAGCAAGATCCTGGGGGAGG + Intronic
996063878 5:119060741-119060763 TTTTAGGAAGTGCCTGGGGGGGG - Intronic
996203259 5:120701049-120701071 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
996344822 5:122477063-122477085 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
996358624 5:122622326-122622348 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
996528053 5:124499306-124499328 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
996574999 5:124970058-124970080 TTGTAGCAAGCTGGGGGAGGAGG + Intergenic
996745447 5:126843017-126843039 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
996912449 5:128670679-128670701 TTGTAGCAGGCTCCTGGGGGAGG + Intronic
996917680 5:128731798-128731820 TTGAAGCAAGATCCTGGGGGAGG - Intronic
997678863 5:135735133-135735155 TTGAAGCAAGTTCCTTGGGGAGG + Intergenic
997746400 5:136303565-136303587 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
997770628 5:136549779-136549801 TTGAAGCAAGATCCTGTTGGAGG + Intergenic
997772645 5:136568806-136568828 ATGTAAAAAGCTCCTGGGGGAGG + Intergenic
997951018 5:138242493-138242515 GTGCAGCAAGCTACTGGGGGAGG + Intergenic
998693704 5:144614796-144614818 ATGTAGCAAGCTCTTGGGGGAGG + Intergenic
998784031 5:145689662-145689684 TTTAAGCAAGCTCCAGGGAGAGG + Intronic
998856286 5:146398283-146398305 TTGTGGCAAGTTCATGGGGCTGG + Intergenic
998995390 5:147865527-147865549 GTGTAGCAAGCTCCTCTGGGAGG - Intergenic
998996397 5:147872431-147872453 TTGTAGGAAGCTCCTGGGAGAGG + Intronic
999618871 5:153453168-153453190 GTGTAGCAAGCTTCTGGGGGAGG + Intergenic
1000519406 5:162278835-162278857 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1000606929 5:163336276-163336298 TTGAGGCAAGATCCTGGGGGAGG - Intergenic
1000885322 5:166742549-166742571 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1000935643 5:167301346-167301368 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1000960553 5:167596373-167596395 TTGTAGGGAGGTCCTTGGGGGGG - Intronic
1001331450 5:170765492-170765514 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1001783559 5:174391708-174391730 TTGAAGCAACCTCCTGGTTGTGG - Intergenic
1002582274 5:180216048-180216070 CTTAAGCCAGCTCCTGGGGGAGG - Intergenic
1002610961 5:180418184-180418206 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1003323840 6:5076997-5077019 TTCGAGGAAGCTCCTGAGGGAGG - Intergenic
1003430167 6:6031241-6031263 TTGTAGTAAGCTCCTGGGGGAGG + Intergenic
1003668615 6:8134595-8134617 ATGTAGCAACCTCCTGGAAGCGG + Intergenic
1004106266 6:12669629-12669651 TTGTGGCAAGCTCCTGTGGGAGG - Intergenic
1004283524 6:14300410-14300432 ATGTAGCAAGCTCCTCGGGGAGG + Intergenic
1004507997 6:16262451-16262473 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1004575223 6:16888208-16888230 TTGTAGCAAGCTCCTGGAGGAGG - Intergenic
1004768575 6:18757524-18757546 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1004837001 6:19541156-19541178 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1005014658 6:21364966-21364988 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1005525622 6:26644962-26644984 CTGTAGCAAGGTGCGGGGGGAGG - Intronic
1005786575 6:29250665-29250687 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1006408132 6:33856897-33856919 TTGTGGCTAGCTCCTGTGGCAGG + Intergenic
1006438109 6:34036996-34037018 TTCCAACAAGCTCCTGGGTGAGG - Intronic
1006568544 6:34981038-34981060 TTGGTGCAGGCTCCTGGGGTAGG + Intronic
1006813139 6:36833579-36833601 ATGTGGCAAGGGCCTGGGGGTGG + Intronic
1007300984 6:40867665-40867687 TTGAAGCAAGATCCTGTTGGAGG + Intergenic
1008476525 6:51940435-51940457 TTGTAGTAAGCTCCTGGGGGAGG - Intronic
1008484474 6:52020539-52020561 TTCTAACAAGCTCCCGGGTGAGG + Intronic
1008850214 6:56014273-56014295 TTGTAGCAAGCTCCTTGGGGAGG + Intergenic
1009269821 6:61602354-61602376 TCGTAGCAAGATCCTGGGGTAGG - Intergenic
1009359356 6:62793756-62793778 TCGTAGCAAGCTCCTGAGGGAGG - Intergenic
1009379144 6:63007566-63007588 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1009464336 6:63952158-63952180 TTGAAGCAAGATCCTGATGGAGG - Intronic
1010071725 6:71752006-71752028 TTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1010586697 6:77664014-77664036 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1010826913 6:80485896-80485918 TTGTAGCAAACTCCTGGGGGAGG + Intergenic
1010829691 6:80513764-80513786 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1010841315 6:80651256-80651278 TTCTAGCAAGCTCCTGGGGGAGG + Intergenic
1010894546 6:81348596-81348618 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1011770945 6:90673671-90673693 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1012014391 6:93833537-93833559 GTGTAGCAAGCTCCTGCGGGAGG + Intergenic
1012066544 6:94557403-94557425 GTGTAGCAAGCTCCTGCGGGAGG + Intergenic
1012315825 6:97781850-97781872 AGGTAGCAAGCTCCTGTGGGAGG - Intergenic
1012675098 6:102104208-102104230 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1012689574 6:102295177-102295199 GTGTAGCAGGCTGCTGTGGGAGG - Intergenic
1013407889 6:109859214-109859236 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1013808086 6:114015771-114015793 TTGAAGCAAGAACCTGGGGGAGG + Intergenic
1013843682 6:114425782-114425804 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1013891702 6:115034132-115034154 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1014115343 6:117663144-117663166 TTGAAGTAAGATCCTGGAGGGGG + Intergenic
1014360161 6:120465725-120465747 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1014396068 6:120927441-120927463 TTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1014454872 6:121623898-121623920 ATGTAGCAAGCTCCTGTGGGAGG + Intergenic
1014555847 6:122842080-122842102 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1014612083 6:123558893-123558915 TTGTGGCAAGGTCCTGGGGGAGG - Intronic
1014614674 6:123585747-123585769 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1014718895 6:124894288-124894310 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1014793992 6:125705320-125705342 ATGTAGCAAGCTCCTGGGGGAGG + Intergenic
1014891543 6:126851005-126851027 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1015165221 6:130194595-130194617 TTGTAGCAAGCTCCTGGGAGAGG - Intronic
1015266734 6:131297707-131297729 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1015269656 6:131325654-131325676 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1015270932 6:131338335-131338357 TTCTAGAAAGCACCTGGGGTAGG + Intergenic
1015278152 6:131405064-131405086 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1015288042 6:131507741-131507763 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1015323829 6:131903937-131903959 GTGTAGTAAGCTCCTGTGGGAGG - Intergenic
1015801378 6:137064784-137064806 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1016114142 6:140260869-140260891 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1016204536 6:141455081-141455103 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
1016248861 6:142018059-142018081 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1016518805 6:144925423-144925445 GTGTAGCAAGCCCCTGGGGGAGG - Intergenic
1016535760 6:145106608-145106630 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1016853268 6:148642051-148642073 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1017389497 6:153923736-153923758 GGGTAGCAAGCTCCTGGGGGAGG - Intergenic
1017779332 6:157704106-157704128 TTGTAGCAACCTCCTGGGGGAGG + Intronic
1018077596 6:160230746-160230768 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1018084497 6:160290030-160290052 CTGTAGCAAGCTCCTGGGGAAGG + Intergenic
1018495402 6:164342192-164342214 TTGTAGCAAGCTCCTGGTGGAGG + Intergenic
1018521469 6:164655610-164655632 CTGTAGCAAGCTCCTGGAGGAGG + Intergenic
1018855868 6:167674521-167674543 TTGTGGCCAGACCCTGGGGGTGG + Intergenic
1019996596 7:4728587-4728609 TGGTAGCAGGTTCCTGGAGGAGG - Intronic
1020316049 7:6906041-6906063 TTGTAGCAAGCTCTTGGGGGAGG - Intergenic
1020323944 7:6960126-6960148 TTGTAGCAAGCTCCTGGGAGAGG + Intergenic
1020532715 7:9356878-9356900 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1020541142 7:9462014-9462036 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1020639751 7:10741034-10741056 GGCTAGCAGGCTCCTGGGGGTGG + Intergenic
1020794214 7:12661818-12661840 TTGAAGCAAGCTCCTGGGGAAGG - Intergenic
1021393623 7:20122854-20122876 TTGTAGCAAGCTTCTGGGGCAGG - Intergenic
1021429848 7:20547700-20547722 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1021637316 7:22705495-22705517 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1021817920 7:24466299-24466321 TTGAAGCAACCTCCTGGTAGGGG + Intergenic
1021977896 7:26027646-26027668 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1022372872 7:29787098-29787120 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1022447404 7:30481483-30481505 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1022572793 7:31470486-31470508 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1022710047 7:32841362-32841384 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1022854710 7:34303351-34303373 TTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1022968550 7:35496596-35496618 ATGTAGCATGCTCCTGGGGAGGG - Intergenic
1023278960 7:38550236-38550258 TTCTAGCAAGCTCCCTGGTGAGG - Intronic
1023698887 7:42874066-42874088 TTGTAACAAGTTCCTGGGGGAGG + Intergenic
1023707906 7:42961414-42961436 TTGAAGTAATCTCCTGGTGGGGG + Intergenic
1024739254 7:52337104-52337126 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1026903213 7:74048328-74048350 CTGGAGCAGGATCCTGGGGGAGG + Intronic
1027157886 7:75781404-75781426 TTGAATCAAGATCCTGGGGTAGG - Intronic
1027158315 7:75784180-75784202 TTATAGCAAGCTCCTGGGGGAGG - Intronic
1027354421 7:77341950-77341972 CTGAAGTAAGATCCTGGGGGAGG - Intronic
1027851944 7:83461916-83461938 ATGTAGCAAGCTCCTGGGGGAGG - Intronic
1028589911 7:92483247-92483269 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1028670509 7:93396182-93396204 TTGCAGCAAGCTCCTGGGGGAGG - Intergenic
1028690177 7:93642112-93642134 TTGCAGCAAGCTCCTGGGGGAGG - Intronic
1029500213 7:100924421-100924443 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1029533560 7:101141855-101141877 TAGTAGCAAGCGGCTGGGCGTGG + Intergenic
1030445784 7:109645577-109645599 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1030751499 7:113237037-113237059 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1031004667 7:116457735-116457757 GTGTAGCAAGCTCCTGGGGGAGG - Intronic
1031296616 7:120011141-120011163 TTGTAGCAAGCTCCTGGTTGGGG - Intergenic
1031355194 7:120780603-120780625 TTGTAGCAAGCTCCTGGGAGAGG + Intergenic
1031364748 7:120889071-120889093 CTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1031399984 7:121317823-121317845 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1031422456 7:121567438-121567460 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1031525591 7:122819172-122819194 ATGTAGCAAGCTCCTGTGGGAGG - Intronic
1031685845 7:124731290-124731312 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1031727933 7:125262361-125262383 TTATAGCAAGCTCCTGGGGGAGG + Intergenic
1031776323 7:125912240-125912262 ATGTAGCAAGTTCCTGTGGGAGG - Intergenic
1031777343 7:125919865-125919887 TTGTAGCAAGCTCTTGGGGGAGG - Intergenic
1032980904 7:137281498-137281520 TTCTAACAAGCACCTGGGTGAGG - Intronic
1033084717 7:138331280-138331302 TTGAAGCAAGATCCTGGGGTAGG - Intergenic
1033088556 7:138364802-138364824 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1033211519 7:139463543-139463565 TTGAAGCAAGATCCTGGTGGAGG - Intronic
1033465035 7:141582244-141582266 TTGAAGCAAGTTCCTGGGGGAGG + Intronic
1033625586 7:143107073-143107095 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1033675952 7:143540681-143540703 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1033695883 7:143788758-143788780 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1033909469 7:146246838-146246860 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1035054192 7:156023026-156023048 TTCTAGGAAGCTCCTGGGTGAGG - Intergenic
1035880665 8:3241675-3241697 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1036070924 8:5440100-5440122 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1036142665 8:6222850-6222872 TTATAACAAGCTCCTAGGGGAGG + Intergenic
1036191523 8:6674957-6674979 ATGTAGCAAGCACTTGGGGCTGG - Intergenic
1036281481 8:7404689-7404711 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1036339988 8:7906883-7906905 ATGTAGCTAGCTCCTGGGGGAGG + Intergenic
1036372131 8:8170858-8170880 TTGTAGCAAGCTCCTGGGGTAGG - Intergenic
1036472331 8:9062894-9062916 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1036564004 8:9922617-9922639 ATGTGGGATGCTCCTGGGGGAGG - Intergenic
1036639493 8:10573520-10573542 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
1036878770 8:12494783-12494805 TTGTAGCAAGCTCCTGGGGTAGG + Intergenic
1038167650 8:25101286-25101308 TTGTAGAACGGTCCTGGGGGAGG - Intergenic
1039499002 8:38002136-38002158 TTGAAGCAAGATCCTGGGAGAGG + Intergenic
1040012483 8:42673947-42673969 ATGAAGGAACCTCCTGGGGGTGG + Intergenic
1040482262 8:47836886-47836908 TTGCAGGGAGCTCCTGGGGTAGG - Intronic
1041651841 8:60309959-60309981 TTGAAGCAAGATCCTGATGGAGG + Intergenic
1041917535 8:63151756-63151778 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1042453556 8:68975423-68975445 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1042706081 8:71666656-71666678 TTGAAGCAAGATCTTGGGGGAGG - Intergenic
1042707368 8:71677163-71677185 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1043092351 8:75921739-75921761 TTAAAGCAATCTCCTGGTGGTGG + Intergenic
1043353672 8:79389564-79389586 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1043597456 8:81901996-81902018 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1043717898 8:83508600-83508622 TTGTGGCAAGCTCCTGGGGGAGG + Intergenic
1043720905 8:83546221-83546243 TTGAAGCAAGATCCTGGGGGAGG - Intergenic
1043837736 8:85065224-85065246 TTATAGCAAGCTCCTGGGGGAGG - Intergenic
1044148518 8:88745674-88745696 GTGTAGCAAGCTCTTGGGGGAGG + Intergenic
1044258616 8:90093663-90093685 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1044417083 8:91950219-91950241 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1044921990 8:97177326-97177348 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1044925157 8:97203170-97203192 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1045644780 8:104288185-104288207 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1046074907 8:109303062-109303084 TTGAAGCAAGATCCTTGGGGAGG - Intronic
1046294118 8:112198074-112198096 TCGTAGCAAGCTCCTGGGGGAGG - Intergenic
1046386343 8:113512972-113512994 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1046440011 8:114243588-114243610 GTGTCGCAAGCTCCTGGGGGAGG - Intergenic
1046443246 8:114284243-114284265 GTGTAGCAAGTTCCTGTGGGAGG - Intergenic
1046512083 8:115214477-115214499 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1046559282 8:115816859-115816881 TTGTAGCAAGCTCCTGGAGGAGG - Intergenic
1047699345 8:127433979-127434001 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1047809167 8:128389630-128389652 TTGTAGGAAAATCATGGGGGAGG - Intergenic
1047829545 8:128615367-128615389 TTGTAGCAAGCTTCTAGGGGAGG + Intergenic
1047856372 8:128916670-128916692 TTGTGGCAAGCTCCTGGGGGAGG - Intergenic
1048135471 8:131742972-131742994 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
1048143771 8:131821436-131821458 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1048168434 8:132083696-132083718 ATGTAGCAAGCTCCTGTGGGAGG + Intronic
1048585421 8:135770600-135770622 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1048728421 8:137411734-137411756 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1049868820 8:144957718-144957740 CTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1050117601 9:2277818-2277840 TTGTAGCAAGCTCCTGGGGGCGG - Intergenic
1050140480 9:2511685-2511707 TTGAAGCAAGATCCTGTGGGAGG - Intergenic
1050258108 9:3814610-3814632 TTGTAGCAAGCTTCTGGGGGAGG + Intergenic
1050302632 9:4274847-4274869 TTCTAACCAGGTCCTGGGGGAGG + Intronic
1050661875 9:7891737-7891759 TTGTGGGAAGGTCCTGGTGGGGG - Intergenic
1050896073 9:10887018-10887040 TTACAGCAAGCTCCTGGGGGAGG - Intergenic
1051052625 9:12950573-12950595 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1051095611 9:13462201-13462223 TTCTAACAAGCTCCTAGGTGAGG - Intergenic
1051382067 9:16469292-16469314 TTGTAGGAAGGACCCGGGGGAGG + Intronic
1051849286 9:21489160-21489182 TTGCAGCAAACTCCTGGGGGAGG + Intergenic
1051953407 9:22662026-22662048 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1052163082 9:25289924-25289946 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1052191835 9:25671178-25671200 TTATAGCAAGCTCTTGAGGGTGG - Intergenic
1052653333 9:31328666-31328688 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1052720642 9:32167970-32167992 TTGCAGCAAGCTCCTGGGGGAGG + Intergenic
1053058031 9:35005740-35005762 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1053059922 9:35022766-35022788 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1053511103 9:38688277-38688299 TTGTATCAAGCACCTAGGGGTGG + Intergenic
1053573003 9:39329320-39329342 TTGTTGCCAGTTCCTGAGGGAGG + Intergenic
1053624351 9:39853507-39853529 TTGTTGCCAGTTCCTGAGGGAGG + Intergenic
1053880517 9:42589720-42589742 TTGTTGCCAGTTCCTGAGGGAGG - Intergenic
1053892152 9:42704610-42704632 TTGTTGCCAGTTCCTGAGGGAGG + Intergenic
1054094567 9:60888029-60888051 TTGTTGCCAGTTCCTGAGGGAGG + Intergenic
1054116036 9:61163941-61163963 TTGTTGCCAGTTCCTGAGGGAGG + Intergenic
1054124141 9:61289691-61289713 TTGTTGCCAGTTCCTGAGGGAGG - Intergenic
1054219544 9:62397190-62397212 TTGTTGCCAGTTCCTGAGGGAGG - Intergenic
1054231170 9:62511983-62512005 TTGTTGCCAGTTCCTGAGGGAGG + Intergenic
1054591721 9:67018603-67018625 TTGTTGCCAGTTCCTGAGGGAGG - Intergenic
1054807489 9:69408211-69408233 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1055233061 9:74087915-74087937 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1055347719 9:75355239-75355261 TTGTGGCAAGCTCCTGGGGGTGG + Intergenic
1055626721 9:78183059-78183081 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1055810045 9:80139663-80139685 ATGTAGCAAGCTCCTGGGGGAGG - Intergenic
1055881746 9:81011259-81011281 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1056044738 9:82704170-82704192 TTGTAGCAAGCTCCTAGGGGAGG + Intergenic
1056061158 9:82886009-82886031 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1056323884 9:85460898-85460920 GTGTCGCAAGCTCCTGGGGGAGG - Intergenic
1056522446 9:87413178-87413200 GTGTCGCAAGCTCCTGTGGGAGG - Intergenic
1056882979 9:90414827-90414849 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1056886853 9:90451091-90451113 ATGTAGCAAGCCCCTGGTGGAGG - Intergenic
1057234845 9:93349857-93349879 GTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1057377992 9:94542079-94542101 TTGTAGCAAGCTCCTTGGGGAGG - Intergenic
1057684001 9:97217095-97217117 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1057812582 9:98269269-98269291 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1057982082 9:99672411-99672433 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1058026208 9:100144152-100144174 TTGTAGCAAGCTTCTTGGGGAGG + Intronic
1058429094 9:104902315-104902337 TTGTAGCAAACTCATGAGGATGG + Intronic
1058612401 9:106790449-106790471 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1059546159 9:115178078-115178100 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1059574621 9:115475611-115475633 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
1059606708 9:115842663-115842685 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1059863487 9:118489132-118489154 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1060226196 9:121792576-121792598 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1060318469 9:122534092-122534114 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1060737884 9:126078086-126078108 TTGTAGCAAGCGCCTGGGGGAGG + Intergenic
1060877352 9:127093034-127093056 TCGTATCAACCTCCTGAGGGAGG - Intronic
1061408418 9:130405271-130405293 CGGTAGCCAGCTCCTGGGGAAGG + Intronic
1061619079 9:131799278-131799300 CAGCAGCCAGCTCCTGGGGGTGG + Intergenic
1203492329 Un_GL000224v1:118964-118986 CTGCAGCAACCTCCTGGGGCAGG - Intergenic
1203504952 Un_KI270741v1:60836-60858 CTGCAGCAACCTCCTGGGGCAGG - Intergenic
1185858430 X:3556582-3556604 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1185960688 X:4543942-4543964 TTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1185991060 X:4893844-4893866 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1186112865 X:6275636-6275658 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1186784067 X:12942075-12942097 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1187086523 X:16048145-16048167 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1187099958 X:16182615-16182637 TTTTAGCAAGCTCCTGGGGGAGG + Intergenic
1187103768 X:16220279-16220301 TTAAAGCAAGCTCCTGGGGGAGG + Intergenic
1187958591 X:24545421-24545443 TTGTAGGTAGATCCTGGGGCTGG + Intergenic
1188200968 X:27292601-27292623 TAGAAGCAAGATCCTGAGGGAGG + Intergenic
1188333020 X:28896048-28896070 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1188419486 X:29977530-29977552 TTGTAGCAAGCTCCTAGGGGAGG - Intergenic
1188431025 X:30105596-30105618 TTGTAGCAAGCTCCTAGGGGAGG - Intergenic
1188463374 X:30452552-30452574 TTGTGGCAAGCTCCTTTGGGAGG + Intergenic
1188552651 X:31379757-31379779 TTGTAGCAAGCTCCTGGGGGAGG - Intronic
1189031813 X:37459226-37459248 TTGAAGCAAGATCCTGATGGAGG + Intronic
1191014196 X:55791764-55791786 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1191135622 X:57060956-57060978 TTATAACTAGCTCTTGGGGGTGG + Intergenic
1191761273 X:64651162-64651184 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1191805807 X:65133091-65133113 TTGAAGCAAGATCCTCGGGCAGG + Intergenic
1191825553 X:65361970-65361992 TTGAAGCAAGATCCTAGGGTAGG - Intergenic
1192454596 X:71266435-71266457 ATGAAGCAAGATTCTGGGGGAGG - Intergenic
1192533685 X:71910960-71910982 GTGTAGCAGGCCCCTGGGCGCGG - Intergenic
1192706142 X:73529918-73529940 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1192731520 X:73806368-73806390 GTGAAGCAAGATCCTGGGGGAGG + Intergenic
1192914131 X:75635723-75635745 TAGAAGCAAGATCCTGTGGGAGG + Intergenic
1193537094 X:82729113-82729135 TTGAAGCAAAATCCTGGGGCAGG - Intergenic
1193885928 X:86984058-86984080 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1193941498 X:87684142-87684164 GTGTAGCAAGCTCCTGAGGGAGG - Intergenic
1194186249 X:90776775-90776797 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1194308541 X:92276516-92276538 TTGTAGCAAGCTCCTGGGGGAGG + Intronic
1194351289 X:92826744-92826766 GTGTAGCAAGCTCCTAGGGGAGG - Intergenic
1194367106 X:93025186-93025208 TTGTAGCAAGCTCCTCGGGGAGG - Intergenic
1194502982 X:94702276-94702298 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1194660688 X:96626279-96626301 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1194822768 X:98527728-98527750 GTGTAGCAAGCTCCTGTGGGAGG + Intergenic
1194873800 X:99162894-99162916 TTATAGCAAGCTCCTGGGGGAGG + Intergenic
1195016954 X:100789877-100789899 TTGAAGCAAGATCCTGGGGGTGG + Intergenic
1195291156 X:103432986-103433008 TTGAAGCAAGTTCCTGGGGGAGG + Intergenic
1195326858 X:103765232-103765254 TTGAAGCAAGTTCCTGGTGGAGG + Intergenic
1195841485 X:109180674-109180696 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1195908677 X:109868672-109868694 TTGTAGCAAGCTCCTGGGGAAGG + Intergenic
1196073082 X:111546170-111546192 ATGTAGCAAGCTCCTGTGGGAGG - Intergenic
1196165544 X:112532869-112532891 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1196220986 X:113112175-113112197 TTGTGGCAAGCTCCTGGGGGAGG + Intergenic
1196227218 X:113180257-113180279 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1196300011 X:114042236-114042258 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1196330824 X:114469016-114469038 GTGTAGCAAGCTCCTGTGGGAGG - Intergenic
1196341716 X:114604759-114604781 GTGTAGCAAGCTCCTGTGGGAGG + Intronic
1196496864 X:116333076-116333098 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1196533541 X:116815921-116815943 GTGTAGCAAGTTCCTGGGGGAGG + Intergenic
1196572499 X:117281412-117281434 TTGTAGCAAGCTCCTGGGGAAGG - Intergenic
1196585125 X:117419916-117419938 TTATACCAAGCTCCTGGACGAGG - Intergenic
1196773854 X:119321222-119321244 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1196992686 X:121346446-121346468 TTGTGGCAAGCTCCTGGGGGAGG + Intergenic
1197064916 X:122224288-122224310 TTATAGCAAGCTCCTCGGGGAGG - Intergenic
1197352059 X:125392302-125392324 GTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1197428116 X:126323435-126323457 TGGGAGAGAGCTCCTGGGGGAGG + Intergenic
1197499723 X:127228853-127228875 TTGTAGCAAGCTTCTGGGAGAGG - Intergenic
1197793638 X:130279288-130279310 TTGAAGCAAGATCCTGATGGAGG - Intergenic
1197933082 X:131714325-131714347 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1198138557 X:133779833-133779855 TTGTAGCAATGGCTTGGGGGTGG - Intronic
1198598449 X:138261073-138261095 TTATAGCAAGTTCCTGGGAAAGG - Intergenic
1198599400 X:138267766-138267788 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1198965923 X:142228803-142228825 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1198983755 X:142427022-142427044 TTGTAGCAAGCTCCTGGAGGAGG + Intergenic
1199439872 X:147855821-147855843 TTTTGGCAGGCTCCGGGGGGGGG + Intergenic
1199576481 X:149317919-149317941 TTGTAGCAAGTTCCTCGGGGAGG - Intergenic
1200022416 X:153223145-153223167 TTGTAGGAGGTTCCTGGGTGGGG + Intergenic
1200532839 Y:4358854-4358876 TTGTAGCAAGCTCCTGGGGGAGG + Intergenic
1200611144 Y:5328239-5328261 GTGTAACAAGTTCCTGGGGGAGG + Intronic
1200659614 Y:5943434-5943456 GTGTAGCAAGCTCCTAGGGGAGG - Intergenic
1200675320 Y:6141442-6141464 TTGTAGCAAGCTCCTCAGGGAGG - Intergenic
1201061661 Y:10051779-10051801 TTGAAGTAAGATCCTGGGGGAGG + Intergenic
1201307506 Y:12563385-12563407 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1201473505 Y:14357853-14357875 TTGAAGCAAGATCCTGGGGTAGG + Intergenic
1201540636 Y:15101696-15101718 TTGAAGCAAGATCCTGGGGGAGG + Intergenic
1201581390 Y:15514628-15514650 TTGTAGCAAGCTCCTGGGGGAGG - Intergenic
1201887689 Y:18903829-18903851 TTGTAGCAAGCTGCAGGTGAAGG - Intergenic