ID: 951888977

View in Genome Browser
Species Human (GRCh38)
Location 3:27551585-27551607
Sequence TAGCAAGCTCCTGGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1184
Summary {0: 323, 1: 289, 2: 106, 3: 91, 4: 375}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888971_951888977 -5 Left 951888971 3:27551567-27551589 CCAGATCTCTGGCACTTGTAGCA No data
Right 951888977 3:27551585-27551607 TAGCAAGCTCCTGGGGGAGGAGG 0: 323
1: 289
2: 106
3: 91
4: 375
951888969_951888977 9 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888977 3:27551585-27551607 TAGCAAGCTCCTGGGGGAGGAGG 0: 323
1: 289
2: 106
3: 91
4: 375
951888967_951888977 25 Left 951888967 3:27551537-27551559 CCTGGCTGTGGGTATTCCTTGGC No data
Right 951888977 3:27551585-27551607 TAGCAAGCTCCTGGGGGAGGAGG 0: 323
1: 289
2: 106
3: 91
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951888977 Original CRISPR TAGCAAGCTCCTGGGGGAGG AGG Intergenic
900514682 1:3075932-3075954 CACCATCCTCCTGGGGGAGGAGG + Intronic
900782756 1:4628751-4628773 GAACAAGGCCCTGGGGGAGGGGG + Intergenic
900788026 1:4661486-4661508 CAGCTAGCTCATGGGAGAGGTGG + Intronic
900840788 1:5047098-5047120 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
900847475 1:5115373-5115395 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
900890582 1:5447013-5447035 TAGCAAGCTCCAGGTTGAGAGGG + Intergenic
901762112 1:11478471-11478493 GAGAAAGAGCCTGGGGGAGGGGG - Intergenic
902050917 1:13563131-13563153 AAGCAAGATCCTGGGGGAGGCGG - Intergenic
902403460 1:16170747-16170769 TAGAATGCTGCTGGTGGAGGGGG + Intergenic
902825708 1:18972672-18972694 TTGCCACCTCCTGGTGGAGGTGG + Intergenic
902970418 1:20044151-20044173 AAGCAAGATCCTGATGGAGGAGG + Intronic
903033809 1:20481614-20481636 GAGCAGGCCCCTGGGGGAGGAGG - Intergenic
903396025 1:23002407-23002429 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
903965141 1:27083550-27083572 TTGCAGGCCCCTGGGGGTGGGGG + Intergenic
904037830 1:27568347-27568369 TGGCAAGATCTTGGGGCAGGTGG + Intronic
904198993 1:28807138-28807160 CAGCAAGCTCCAGGAGGGGGAGG - Intergenic
904393960 1:30205643-30205665 AAGCAAAATCCTGGGGGAGGAGG - Intergenic
904711635 1:32434598-32434620 TACCAAGCTCTTGGGGGAGGAGG - Intergenic
904996479 1:34635417-34635439 TAGCAAGCTCCTGGGGGAAGAGG + Intergenic
905060519 1:35135790-35135812 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
905069196 1:35210495-35210517 TAAGAAGCTCCGGGGGGAGGAGG - Intergenic
905499781 1:38427332-38427354 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
905970208 1:42136167-42136189 TAGTAAGTTCCTGGGGTTGGGGG - Intergenic
906140162 1:43529619-43529641 TAGCAAGCGGCGGGGGGAGGAGG + Intronic
906249821 1:44302384-44302406 TAGCAGCCTGCTGGGGGAAGGGG - Intronic
906586825 1:46985400-46985422 GAGAAAGCACCTGGGGGAAGGGG + Intergenic
906934077 1:50196356-50196378 CAGGAAGCTCCTGGGGCAGGGGG + Intronic
907123713 1:52031063-52031085 TAACTAGCTGTTGGGGGAGGTGG - Intronic
907292634 1:53426547-53426569 TAGCAAACTCCTGGGGGAGGAGG - Intergenic
907293604 1:53434497-53434519 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
907503566 1:54901320-54901342 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
907521260 1:55024851-55024873 TAGCAAACTCCTGGGGGAGGAGG - Intergenic
908461714 1:64353427-64353449 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
908591953 1:65645335-65645357 TAGCAAGCTCCTATGGGAGGAGG + Intergenic
908852405 1:68388516-68388538 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
909222659 1:72983292-72983314 TAGCAGGATCCTGGAGGAGGAGG + Intergenic
909223651 1:72991243-72991265 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
909374165 1:74921167-74921189 AAGCAAGATCCTGGGGTAAGAGG - Intergenic
909551018 1:76898233-76898255 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
909788267 1:79642184-79642206 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
909792976 1:79699803-79699825 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
909909962 1:81247690-81247712 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
909978449 1:82070975-82070997 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
910049382 1:82957567-82957589 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
911147984 1:94570318-94570340 TAGCAAGCTCCTGGGGTAAGAGG + Intergenic
911510614 1:98804700-98804722 TAACAAGCTCCTTGGGGAGGAGG + Intergenic
911612296 1:99970225-99970247 CGGGAAGCTCCTGGAGGAGGAGG + Intronic
911759781 1:101601494-101601516 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
911836561 1:102626406-102626428 TAACAAGATCCTGGAGGAGAGGG - Intergenic
911966929 1:104382438-104382460 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
912296476 1:108475202-108475224 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
912813566 1:112811690-112811712 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
912815307 1:112823927-112823949 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
913245135 1:116864383-116864405 AAGCAAGATCCTGGGGTAGGCGG - Intergenic
913336701 1:117715634-117715656 TGGCCAGAACCTGGGGGAGGGGG + Intergenic
916941794 1:169685118-169685140 AAGCAAGATCCTGATGGAGGAGG - Intronic
917265405 1:173215935-173215957 TAACAAGCTCCTGAGTGACGTGG - Intergenic
917356493 1:174131483-174131505 TACCAAGCTCCTGGGGGGAAGGG - Intergenic
917525846 1:175787826-175787848 AAGCCAGATCCTGGGGTAGGGGG - Intergenic
918114859 1:181486873-181486895 TAGCAAGCTCCCAGGTGATGTGG - Intronic
918168692 1:181974950-181974972 TGGCAAGTTCCTGGGGAAAGGGG + Intergenic
918347118 1:183615898-183615920 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
918516565 1:185369924-185369946 GAGCCAGCTCCTGGAGGAGGAGG + Intergenic
918567670 1:185951759-185951781 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
918714404 1:187768956-187768978 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
919476400 1:198037044-198037066 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
919747949 1:201020393-201020415 TGGCAGTCACCTGGGGGAGGAGG - Intronic
920275483 1:204801414-204801436 GAGCAACCTGCTGGGGGATGGGG + Intergenic
920380419 1:205531757-205531779 TAGGCAGGTCCTGGGGGAGGAGG - Exonic
920735234 1:208527449-208527471 TTGGCAGCCCCTGGGGGAGGGGG + Intergenic
920829402 1:209451186-209451208 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
920901529 1:210114272-210114294 AAGCAAGATCCTGGGGGAGGAGG + Intronic
921212422 1:212911756-212911778 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
921459778 1:215413403-215413425 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
921509260 1:216010257-216010279 TAGCAAGCTCCTGGAGGAGGAGG - Intronic
921520131 1:216147798-216147820 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
921732972 1:218597252-218597274 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
921736456 1:218633806-218633828 TACCGAACTCCTGGGGGAAGGGG - Intergenic
922048415 1:221968206-221968228 TAGCAAACTCCTGGGGGAGGAGG - Intergenic
922049531 1:221976566-221976588 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
922154067 1:223027866-223027888 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
922363544 1:224843916-224843938 AAGCAAGCTCCTGGGGGAGGAGG + Intergenic
922598976 1:226835518-226835540 AAGCAAGATCCTGGGGCAGGAGG - Intergenic
922906398 1:229176670-229176692 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
922934824 1:229414635-229414657 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
923075207 1:230603480-230603502 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
923185032 1:231563523-231563545 AAGCAAGGTCCTGGAAGAGGTGG + Intronic
923244754 1:232120429-232120451 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
923257271 1:232232664-232232686 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
923408621 1:233686895-233686917 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
923770735 1:236935714-236935736 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
923962786 1:239103621-239103643 TAGCAAGCCTCTGGGGGAGGAGG - Intergenic
924845245 1:247762115-247762137 TATGAAGCTCCTGGGTGTGGTGG + Intergenic
924896179 1:248339690-248339712 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1063106407 10:2996441-2996463 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
1063363169 10:5473362-5473384 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1063403771 10:5773161-5773183 TAGCAACCTCCTGGGTGGTGGGG - Intronic
1063509596 10:6633055-6633077 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1063527679 10:6800552-6800574 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1063570552 10:7211137-7211159 TAGAAAGCACCTGGGGTGGGCGG + Intronic
1063667220 10:8070184-8070206 GAGCTAGCTCCTGAGGAAGGTGG + Intronic
1064663811 10:17630305-17630327 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1064874484 10:19977440-19977462 TAGGAGGCCACTGGGGGAGGGGG + Intronic
1064886992 10:20122620-20122642 TAGCAAGCTCCTGGGGAAGGAGG + Intronic
1065437632 10:25718697-25718719 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1065443119 10:25772200-25772222 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
1066103395 10:32137116-32137138 AAGCAAGATCCTGGGGGAGGCGG + Intergenic
1067085417 10:43235549-43235571 TAGCAAGCTCCTGGGCAGTGTGG - Intronic
1067360405 10:45573463-45573485 AAGCAAGTTCCTGGGGGAGGAGG - Intronic
1067460962 10:46458190-46458212 TCTCTAGCTCCTGGGGGTGGTGG - Intergenic
1067626231 10:47926410-47926432 TCTCTAGCTCCTGGGGGTGGTGG + Intergenic
1068058346 10:52037225-52037247 TAGCAAGCTCCTGTGGGAGGAGG + Intronic
1068179655 10:53502496-53502518 TAGCAAGCTTCTGTGGGAGGAGG + Intergenic
1068230976 10:54169006-54169028 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1068592341 10:58864478-58864500 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1069591021 10:69641877-69641899 CACGCAGCTCCTGGGGGAGGAGG - Intergenic
1070474929 10:76820820-76820842 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1071550787 10:86564698-86564720 AAGCAATATCCTGGGGGAGATGG + Intergenic
1071897730 10:90084501-90084523 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1071916203 10:90297256-90297278 TAGCAAGTTCCTGGGGGAGGAGG - Intergenic
1071961115 10:90809676-90809698 TAGCAAGCTCCTGGCAGAGGAGG - Intronic
1072011275 10:91304948-91304970 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1072307672 10:94122884-94122906 CAACAAACTCCTGGGTGAGGAGG + Intronic
1072580262 10:96734463-96734485 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1072620025 10:97073632-97073654 TGACAAGCACCTGGGGGATGCGG + Intronic
1072884527 10:99261841-99261863 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
1073014021 10:100383996-100384018 AAGAAAGATCCTGGGGGAGGCGG - Intergenic
1073221870 10:101881315-101881337 TAGCAAGCTCCTGGGTCACTTGG + Intronic
1073506654 10:104000213-104000235 AAGCAAGCTCCTTGGGGACAGGG + Intronic
1073709488 10:106021080-106021102 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1074395349 10:113093215-113093237 TAGCAACCTTATGAGGGAGGTGG + Intronic
1074740144 10:116478614-116478636 TAGAGATCTCCTGGGTGAGGAGG - Intergenic
1074740781 10:116482904-116482926 CAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1075248700 10:120847099-120847121 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1075263486 10:120981859-120981881 TATCCTGCTCCTGGGGCAGGAGG - Intergenic
1075816891 10:125271482-125271504 TGGGAGGCTCCTGGGGAAGGGGG + Intergenic
1076209524 10:128629291-128629313 TTGCCAGGGCCTGGGGGAGGGGG - Intergenic
1076582014 10:131518056-131518078 TAGCAAGCGCATGGGGGCAGGGG + Intergenic
1076981062 11:205046-205068 TCTCTAGCACCTGGGGGAGGGGG + Exonic
1077589875 11:3483095-3483117 TAGCAAGCTCCTGAGAGAGGCGG + Intergenic
1077612186 11:3650186-3650208 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1077679065 11:4222706-4222728 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1077688501 11:4319347-4319369 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1077718428 11:4603711-4603733 TAACAAGCTCCTAGGTGATGTGG - Intronic
1077766381 11:5163745-5163767 TAGCAAGCTCCTGGGGGAGGTGG + Intronic
1077850794 11:6073298-6073320 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1077855028 11:6115798-6115820 TACCTAGTTCCTGGGGGAAGGGG + Intergenic
1077883360 11:6368064-6368086 TAGCGAGCTCCTGGGGGACATGG - Intergenic
1077888880 11:6404946-6404968 TAGCAAGCTCCAAGCGGGGGAGG - Intronic
1078046122 11:7915622-7915644 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1078215887 11:9311544-9311566 TGCGGAGCTCCTGGGGGAGGAGG + Intronic
1078866059 11:15298432-15298454 TAGTAAGGTCCTTGGGAAGGTGG + Intergenic
1079230515 11:18645280-18645302 CAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1079447465 11:20570039-20570061 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1079672569 11:23187400-23187422 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1079727071 11:23890643-23890665 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1080027914 11:27632545-27632567 TGGCAAGCTCCTGGGGGAGGAGG + Intergenic
1080227359 11:29975659-29975681 TAGCAAACTCGTGGGGGAGGAGG - Intergenic
1080994447 11:37582081-37582103 AAGCAAGATCTTGGGGGATGAGG + Intergenic
1081356808 11:42122826-42122848 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1081596993 11:44466374-44466396 ATGCAAGATCCTGGGAGAGGTGG + Intergenic
1081995293 11:47359813-47359835 TGGCAGTCTCCTGGGGGACGGGG + Intronic
1082014336 11:47473181-47473203 CACCAAACTCCTGGGGCAGGTGG + Exonic
1082197759 11:49324894-49324916 AAGCAAGATCCTGAGGGAGGAGG + Intergenic
1083534412 11:63455160-63455182 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1083815943 11:65132496-65132518 TGGGAACTTCCTGGGGGAGGGGG + Intronic
1083920037 11:65777702-65777724 GAGCAGGCTCCTGGGGGTGAGGG - Exonic
1084047171 11:66575869-66575891 TAGCAAGCTCCTGGAGAAGGTGG - Intergenic
1084151752 11:67290820-67290842 GAGCCTGCTCCTGGGGTAGGGGG - Intronic
1084232305 11:67761934-67761956 TGGCAAGCTCCTGGGGGAGGAGG - Intergenic
1084355555 11:68635962-68635984 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1084613272 11:70217738-70217760 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1084827093 11:71739709-71739731 TAGCAAGCTCCTGGGAGAGGCGG - Intergenic
1084849352 11:71926439-71926461 TAGCAAGCTCTTTGAGGATGTGG + Intronic
1085011009 11:73141916-73141938 TAGCAAGGACCAGGAGGAGGAGG + Exonic
1085529075 11:77181134-77181156 GAGCAGGCTCCTGGAGGAGGTGG + Intronic
1085627289 11:78083227-78083249 AAGCAAGATCCTGAGGGAGGAGG - Intergenic
1085934272 11:81124074-81124096 TAGCAAGCTCCTGGATGATGAGG - Intergenic
1085988017 11:81808465-81808487 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1086005021 11:82027471-82027493 TAACAAGCTCCTGGGGGAGGTGG - Intergenic
1086134833 11:83435042-83435064 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
1086136267 11:83446364-83446386 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
1086658061 11:89383233-89383255 AAGCAAGATCCTGAGGGAGGAGG - Intronic
1087099101 11:94347970-94347992 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1087099644 11:94351903-94351925 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1087196919 11:95311773-95311795 TAGAGAGCTCCTGGGGGAGGAGG - Intergenic
1087314677 11:96590175-96590197 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1087641417 11:100759169-100759191 TAGCAAGCTGCAGGGTGATGGGG - Intronic
1087785201 11:102346916-102346938 TACCATTCTCCTGGGGGACGTGG - Intergenic
1087839539 11:102907540-102907562 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1088554963 11:111052443-111052465 TAGCAAGCTCCTCGGGGAGGAGG - Intergenic
1089286041 11:117408840-117408862 TAGAAAGCACGTGGGAGAGGTGG + Intronic
1089349096 11:117811532-117811554 TAGTAAGCTCCTGGGGGAGGAGG - Intronic
1089432354 11:118435347-118435369 TAGTAAGCTGAGGGGGGAGGGGG - Intergenic
1089471052 11:118720460-118720482 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
1089756668 11:120692415-120692437 GAGCAGGCTAGTGGGGGAGGTGG + Intronic
1089867047 11:121641385-121641407 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1089987685 11:122829373-122829395 TAGGAAGCTCCTGGGGGAGGAGG - Intergenic
1090526806 11:127546193-127546215 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1090850594 11:130567824-130567846 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1091393818 12:141655-141677 TGGGAGGGTCCTGGGGGAGGGGG - Intronic
1091396370 12:156237-156259 TAGCAAGGCCCTTGGGGAGCAGG + Intronic
1091886519 12:4020781-4020803 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1092416175 12:8292000-8292022 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1092626745 12:10336390-10336412 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1092723717 12:11465631-11465653 TAGCAAGCTCCTGTGGGAGGAGG + Intronic
1092739321 12:11613156-11613178 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1092789711 12:12060643-12060665 TAGCAAGCTCCTCGGGGAGGAGG - Intronic
1092924852 12:13263432-13263454 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1093024333 12:14232830-14232852 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
1093071162 12:14708335-14708357 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1093268008 12:17025165-17025187 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1093321985 12:17723739-17723761 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1093358438 12:18197201-18197223 TAGCAAGCTCCTGGGGAAGGTGG - Intronic
1093578818 12:20765627-20765649 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1093584516 12:20820463-20820485 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1093812834 12:23509473-23509495 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1093942353 12:25068517-25068539 TGCCAAGCTCCTGGGAGGGGAGG - Intronic
1093951072 12:25165398-25165420 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1094316050 12:29138463-29138485 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1094524021 12:31219896-31219918 GGGCAGGCTCCTGGAGGAGGGGG - Intergenic
1094825757 12:34267888-34267910 TAGCAAGCTCCTGGGGGAGAAGG - Intergenic
1095501775 12:42847589-42847611 TACCATGCTCCTGGGGTGGGGGG - Intergenic
1095637655 12:44452047-44452069 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
1095999024 12:48113593-48113615 AAGCAAGATCCTGGGGGAGGCGG + Intronic
1096709280 12:53443495-53443517 TGGGGAGCTCCTGGGGGAGGAGG - Exonic
1096860947 12:54527709-54527731 GAGCAAGTGCCTGGGAGAGGCGG + Intronic
1096907191 12:54946389-54946411 AAACAAGATACTGGGGGAGGAGG + Intergenic
1097398589 12:59104090-59104112 TGGCAAGTTCCTGGGGGAGGAGG - Intergenic
1097417052 12:59326680-59326702 TAGCAAGCTCCTGTTGGAGGAGG + Intergenic
1097713019 12:62935237-62935259 TCGTGACCTCCTGGGGGAGGGGG + Intergenic
1098173636 12:67770109-67770131 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1098402250 12:70087651-70087673 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1098580325 12:72091858-72091880 TAGCAAGATCAAGGAGGAGGAGG - Intronic
1098629061 12:72705600-72705622 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1098630030 12:72712355-72712377 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1098653826 12:73005425-73005447 TAGCAGGCTCCTGGGGGAGGAGG + Intergenic
1098919907 12:76293710-76293732 AAGCAAGCTCCTTGGGGAGGAGG - Intergenic
1099188716 12:79542110-79542132 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1099292100 12:80786538-80786560 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1099762588 12:86941050-86941072 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1100561361 12:95751427-95751449 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1100940298 12:99717438-99717460 TAGCAAGCTCCTGGGGGAGGCGG - Intronic
1101278397 12:103226141-103226163 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1101713680 12:107291889-107291911 TCTCAAGCTACTGGGGGTGGGGG + Intergenic
1102116740 12:110408723-110408745 AAGCAAGATCCTGGGGTAGGTGG + Intergenic
1103191231 12:119003695-119003717 CAGCAAGCCCCTGGGGGAGCTGG - Intronic
1103958794 12:124594591-124594613 TGGCATTCTCCTTGGGGAGGCGG - Intergenic
1104049521 12:125186355-125186377 GAGCGAGCGCCGGGGGGAGGAGG - Intergenic
1104257607 12:127154043-127154065 AAGCAAGATCCTGATGGAGGAGG - Intergenic
1104348583 12:128025116-128025138 TAGCAAGCCCCTGGGGGACCTGG - Intergenic
1104876917 12:132041351-132041373 TAGCCAGCATCTGGTGGAGGAGG + Intronic
1105211746 13:18261203-18261225 CAGGAAGTTCCTGGTGGAGGAGG - Intergenic
1105938005 13:25119690-25119712 TAGAAAGGTCCTGGGAAAGGTGG - Intergenic
1106462013 13:29979279-29979301 GAGCAAGCTTCTGGGGAAGCAGG + Intergenic
1106943445 13:34800894-34800916 TAGCAAGCTTCTGTGGGAGGAGG - Intergenic
1107075580 13:36318693-36318715 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1107455000 13:40546626-40546648 GCGCAAGCTCCTGGAGCAGGAGG + Intergenic
1107683140 13:42870879-42870901 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1107737253 13:43412860-43412882 GAGGAAGCTCCTGGGGAAGCTGG + Exonic
1108202697 13:48058648-48058670 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1108282063 13:48870584-48870606 GAGCAAGATCCTGGGGCAGGCGG + Intergenic
1108512997 13:51172118-51172140 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1108814128 13:54269107-54269129 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1108815695 13:54287341-54287363 TGCCAAGTTCCTGGGGGAAGGGG - Intergenic
1108913418 13:55581706-55581728 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1108919544 13:55658435-55658457 TAGCAAGCTCCTATGGGAGGAGG + Intergenic
1108947437 13:56042562-56042584 TAGCAAGCTCATATGGGAGGAGG - Intergenic
1108952946 13:56115879-56115901 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1109343583 13:61090607-61090629 TAGCAAGCTCCTGTGGGAGGCGG - Intergenic
1109352919 13:61207038-61207060 TAGCAAGCTCCTGTGGGAGGCGG - Intergenic
1109499295 13:63215374-63215396 TAGCAAGCTCCTAGGGGAGGAGG - Intergenic
1109709665 13:66144798-66144820 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1109716741 13:66229842-66229864 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1110765477 13:79276386-79276408 TAGGAAGCTCCTGGGGGAGGAGG - Intergenic
1110845343 13:80185923-80185945 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1110978492 13:81868425-81868447 TAGCAAGCTTCTGGGGGAGGAGG - Intergenic
1111126042 13:83911742-83911764 TAGCAAGCTCCTGGGGGAAGAGG + Intergenic
1111302049 13:86360657-86360679 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1111362106 13:87189888-87189910 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1111630441 13:90841691-90841713 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1111631701 13:90852048-90852070 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1112236829 13:97644567-97644589 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1112355556 13:98672113-98672135 TAGTGACCTCCTGGGGGTGGGGG + Intergenic
1112889316 13:104211518-104211540 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
1113324338 13:109267598-109267620 CAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1113368907 13:109705153-109705175 TAGGAAGCACCTGGTGGAAGAGG + Intergenic
1113430615 13:110247063-110247085 TAGAAAGCTCTTGGGGTTGGGGG + Intronic
1113527534 13:110992318-110992340 GAGCAAGCGGCTGCGGGAGGAGG - Intergenic
1113561566 13:111285803-111285825 CTGCACGCTCCTGAGGGAGGAGG - Intronic
1113788762 13:113016412-113016434 TGCCAAGCCCCTGGGGGAGCTGG + Intronic
1113881260 13:113627934-113627956 AGGGGAGCTCCTGGGGGAGGAGG + Intronic
1114049937 14:18914253-18914275 CAGCATGCTCCAGGGCGAGGTGG - Intergenic
1114112620 14:19487677-19487699 CAGCATGCTCCAGGGCGAGGTGG + Intergenic
1114221678 14:20702834-20702856 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
1114453828 14:22843063-22843085 CAGCAAGCTCCTCTGGGTGGAGG - Intronic
1115240600 14:31248804-31248826 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
1115904809 14:38193042-38193064 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1116179678 14:41518194-41518216 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1116573456 14:46546178-46546200 TAGCAAGCTCTTGGGGGAGGAGG - Intergenic
1116613515 14:47106432-47106454 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1116703290 14:48265835-48265857 TAGCAAGCTCCTGGGGGGGGAGG + Intergenic
1116713485 14:48398476-48398498 TAACAAGTTCCTGGCTGAGGAGG + Intergenic
1116952914 14:50895422-50895444 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1117174155 14:53130647-53130669 AAGCAAGATCCTGGGGGAGGAGG - Intronic
1117722194 14:58638460-58638482 TGGGGAGCTACTGGGGGAGGCGG + Exonic
1117801185 14:59446307-59446329 TAGCAAGCTCCTGGGGGAGGTGG - Intronic
1117957910 14:61136883-61136905 TAGCAAGCTCCTGCGGGAGGTGG + Intergenic
1118530632 14:66701766-66701788 TACCAAGCTCCTGGGGGGAGGGG + Intronic
1118558345 14:67051077-67051099 AACCAAGTTCCTAGGGGAGGGGG + Intronic
1118838671 14:69494962-69494984 TAGCATGGACCTGGAGGAGGAGG - Intronic
1119022435 14:71126577-71126599 TAGCAAGCTCCTGGGGAAGGAGG - Intergenic
1119317203 14:73705742-73705764 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1120420008 14:84272745-84272767 TAGCTAGCTCCAGGGGAACGGGG + Intergenic
1120438050 14:84503666-84503688 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1120539557 14:85736434-85736456 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1120618257 14:86733600-86733622 TTGCAAGCTCTTGGGGGAGGAGG - Intergenic
1120659954 14:87238498-87238520 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1121289418 14:92762119-92762141 AAGCAAGATCCTGAGGGAGGAGG - Intergenic
1121522135 14:94593457-94593479 TAGCTGGCTCATGGGGGAGCTGG - Intronic
1121703652 14:95975199-95975221 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1122040998 14:98987450-98987472 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1123153455 14:106203806-106203828 TAGAGACCTCCTGGAGGAGGAGG - Intergenic
1123153461 14:106203833-106203855 TAGAGACCTCCTGGAGGAGGAGG - Intergenic
1123153467 14:106203860-106203882 TAGAGACCTCCTGGAGGAGGAGG - Intergenic
1123705484 15:22947916-22947938 GAGCCAGCTCCAGGGAGAGGGGG + Intronic
1123882492 15:24689040-24689062 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1124554332 15:30711054-30711076 TGGCCAGGTGCTGGGGGAGGTGG + Intronic
1124597375 15:31102242-31102264 AGGCAAGCTCCTGGTGAAGGGGG - Intronic
1124676913 15:31694623-31694645 TGGCCAGGTGCTGGGGGAGGTGG - Intronic
1125045778 15:35241021-35241043 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1125205934 15:37153602-37153624 GATCAAGCTCCTTGAGGAGGTGG + Intergenic
1125213216 15:37239656-37239678 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1125534961 15:40437448-40437470 TAGGAAGCCCCTGGGGGGTGGGG - Intergenic
1125629222 15:41133759-41133781 AAACAAGATCCTGGGGGAGGAGG - Intergenic
1125903781 15:43371484-43371506 GAGCCAGCGCCTGGGGGAGTAGG + Intronic
1126530152 15:49702597-49702619 TAGCAAGCTCCTGGGGGAGAAGG + Intergenic
1126684375 15:51234694-51234716 GAGGAAGCTCATGGGGCAGGAGG - Intronic
1126743590 15:51802507-51802529 TAGCCAGCTACTTGGAGAGGAGG + Intronic
1126843749 15:52740838-52740860 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1126912404 15:53430293-53430315 TAGGAAGCTCCTGGGGGAGGAGG + Intergenic
1128084405 15:64875842-64875864 TAGGAAGCCCCTGGGGAGGGCGG + Intronic
1128928290 15:71679251-71679273 GAGGAGGCACCTGGGGGAGGTGG + Intronic
1128984411 15:72208673-72208695 TAGGAAGGTCCTGGGAGAGAAGG - Exonic
1129259438 15:74356180-74356202 AAGCAAGATCCTGGGGCAGGTGG - Intronic
1130548786 15:84875872-84875894 TAGCAAGGTGAGGGGGGAGGAGG - Intergenic
1130855116 15:87833518-87833540 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1130945943 15:88550962-88550984 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1131164872 15:90135089-90135111 AAGCAAGGTCCTGATGGAGGAGG - Intergenic
1131295001 15:91140019-91140041 TAGCAAGCTCCCAGGTGATGCGG - Intronic
1131447750 15:92513762-92513784 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
1131684182 15:94753025-94753047 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1132340414 15:101074788-101074810 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1132804254 16:1768429-1768451 CAGCGGCCTCCTGGGGGAGGCGG - Intronic
1133651396 16:7816955-7816977 TAGCAAGCGCCTAGGGCAGGAGG - Intergenic
1133765735 16:8836474-8836496 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1133766762 16:8843541-8843563 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1133869542 16:9674574-9674596 TAGCAATCTCCTGGGGGAGGAGG + Intronic
1133938177 16:10285406-10285428 AAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1134342177 16:13356029-13356051 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1135002870 16:18791234-18791256 TAGCAAGGCCCTGGGGTACGAGG + Intronic
1135025413 16:18995590-18995612 GAGCAAGATCCTGGGGGAGGCGG + Intronic
1136365876 16:29809079-29809101 TCTCCAGCTCCTGGGGCAGGTGG + Intronic
1136529952 16:30861408-30861430 AAGCAAGATCCTGGGGGAGGAGG - Intronic
1138759100 16:59521089-59521111 TAGCAAGCTCCTGGGGAAGGTGG + Intergenic
1138804951 16:60081084-60081106 TAGCAAGCTCCTAGGGGAGGAGG - Intergenic
1139039235 16:62982604-62982626 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1139225914 16:65233293-65233315 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1139230599 16:65278710-65278732 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
1139423822 16:66866526-66866548 TAGCCAAATCCTGGGGGAGCAGG + Intronic
1139943049 16:70619925-70619947 TAGCAAGCTCCTGTGGGAGGAGG + Intronic
1139943719 16:70624242-70624264 TAGCAAGCTCCTGGGGAAGGAGG + Intronic
1139952006 16:70677099-70677121 TAGGAGGAGCCTGGGGGAGGGGG - Intronic
1139955975 16:70693176-70693198 TAGGACACTCCTGGGGGAGGTGG - Intronic
1140855631 16:78975480-78975502 CAAAAGGCTCCTGGGGGAGGGGG - Intronic
1141310398 16:82908242-82908264 TAGCTAGAACCTGAGGGAGGAGG + Intronic
1141720637 16:85753394-85753416 CAGCAGCCTCCTGGGGGAGGAGG - Intergenic
1141865202 16:86745482-86745504 TAGCAAGGTCCTTGGGGAGGAGG + Intergenic
1142051210 16:87959534-87959556 TAGCAGGCTCTCCGGGGAGGAGG + Intronic
1142163044 16:88569275-88569297 TCTCAAACTCCTGGAGGAGGTGG + Intergenic
1142952846 17:3497782-3497804 TAACAGGCTCCTGGGTGATGCGG + Intronic
1142980626 17:3669016-3669038 TCGGAAGCTCCAGGGGGAGGGGG + Intronic
1143414344 17:6735063-6735085 TAGCAAGCTCCTGAGGGAGGAGG + Intergenic
1143774030 17:9186123-9186145 TAGCAACTGCCTGGGGCAGGAGG + Intronic
1144104673 17:11974147-11974169 TAGTAAGCTCCTGGGGGAGGAGG - Intergenic
1145302647 17:21652111-21652133 TTCCAAACTCCTGAGGGAGGCGG + Intergenic
1145347655 17:22051077-22051099 TTCCAAACTCCTGAGGGAGGCGG - Intergenic
1145782467 17:27572012-27572034 CTGCCAGCTGCTGGGGGAGGGGG + Intronic
1146597898 17:34185526-34185548 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1147178141 17:38669473-38669495 TTTAAAGCTTCTGGGGGAGGGGG + Intergenic
1147188871 17:38727349-38727371 TTGCAAGGGCTTGGGGGAGGGGG + Exonic
1147783988 17:42964825-42964847 AAGCAAGGAGCTGGGGGAGGTGG + Intronic
1148865858 17:50628252-50628274 AGGCAACCTCCTGGTGGAGGTGG + Intergenic
1149319569 17:55470051-55470073 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
1150196560 17:63305106-63305128 TACCAAGCTCCTGGGGGTAGCGG - Intronic
1150648046 17:66992149-66992171 CGCCAAGCTCCTGGGGGGGGGGG + Intronic
1151589080 17:75031692-75031714 TAGATAGCAGCTGGGGGAGGTGG - Intergenic
1151839754 17:76609412-76609434 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1151850104 17:76685022-76685044 TGGCGGGCTCTTGGGGGAGGGGG - Intronic
1151967144 17:77437349-77437371 TAGGGAGCTCCTGGGGGCGTGGG - Intronic
1151969587 17:77450850-77450872 CAGCAAGCACCTGGGGTAGAGGG + Intronic
1153248973 18:3101510-3101532 TAGCCAGCTCCTGGTAGAGATGG + Intronic
1153269408 18:3304948-3304970 TGGCAAGCTCCCAGGTGAGGTGG + Intergenic
1155000623 18:21682419-21682441 AACAAAGCGCCTGGGGGAGGTGG - Intronic
1155173820 18:23286292-23286314 TAGCAAGCTCCTGGGGGAGGCGG - Intronic
1155697015 18:28696558-28696580 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1156237361 18:35218021-35218043 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1156251930 18:35359766-35359788 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1156302249 18:35846146-35846168 TAGCGAGCTCCTGGGGGAGGCGG - Intergenic
1156924052 18:42555948-42555970 TAGCAAGCTCCAGGGGGAGGAGG + Intergenic
1156938532 18:42738904-42738926 TAGCAAGCTCCAGGGGGAGGAGG - Intergenic
1156958180 18:42993126-42993148 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1157663969 18:49469924-49469946 TGGGGAGCTCCTGAGGGAGGAGG - Intergenic
1157794448 18:50560761-50560783 TAGGTAGCCCCTGGGAGAGGGGG + Intronic
1157906390 18:51573496-51573518 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1158336378 18:56417843-56417865 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1158394643 18:57070084-57070106 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1158576695 18:58644439-58644461 AAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1158623134 18:59049755-59049777 TAACAAGCACCCTGGGGAGGGGG + Intergenic
1159164468 18:64683893-64683915 TAGCAAGTTCCTGGGGGAGGAGG - Intergenic
1159465600 18:68779121-68779143 TATCAAGCTACTGGGAGATGAGG - Intronic
1159835053 18:73326889-73326911 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1159929219 18:74294685-74294707 AAGCAAGATCCTGGGGTAGGAGG - Intergenic
1160134398 18:76260293-76260315 AAGCAAAGTCCTGGGGGTGGGGG + Intergenic
1160325880 18:77948082-77948104 CAGCGAGTTCCTGGTGGAGGAGG + Intergenic
1160377460 18:78423829-78423851 TAACAAGTTCATGGAGGAGGTGG - Intergenic
1161028843 19:2048767-2048789 CAGGAGGCTGCTGGGGGAGGAGG + Intronic
1161252836 19:3290259-3290281 CTCCAAACTCCTGGGGGAGGTGG - Exonic
1161434461 19:4254414-4254436 TGAGAAGCTCCTGGAGGAGGAGG + Exonic
1161661719 19:5550723-5550745 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1161711217 19:5849342-5849364 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1161712041 19:5854362-5854384 AAGCAAGATCCTGGGGCAGGAGG - Intergenic
1162262212 19:9542488-9542510 AAGCAAGAACCTGAGGGAGGAGG - Intergenic
1163487291 19:17595681-17595703 TAGCAAGCTCCTGGTGGAGGAGG - Intergenic
1163907185 19:20157785-20157807 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1163944450 19:20522538-20522560 AAGCAAGATCCTGAGGGAGGCGG + Intergenic
1164152973 19:22570493-22570515 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1164202503 19:23030278-23030300 AAGTAAGATCCTGGGGGAGGAGG + Intergenic
1164240649 19:23385218-23385240 TATCAAGCTGCAGGGGGAGGAGG - Intronic
1164459229 19:28433320-28433342 TAGCAAGCTTCTGGGGGAGGTGG + Intergenic
1164669450 19:30064343-30064365 TAGCCAGCTCCCGGGGGACTGGG - Intergenic
1164831310 19:31323231-31323253 CAGCATGCTCCTGGGTGAGTTGG - Intronic
1165497004 19:36158875-36158897 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1165510317 19:36262941-36262963 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1165835359 19:38751863-38751885 TAGCAAGCTCCTGGGGGAGGCGG - Intronic
1165941382 19:39416345-39416367 TAGCGAGCTCCTGGAGGACTTGG + Exonic
1166011130 19:39943536-39943558 TGGGGAGCTCCTGGGGGAGGAGG + Intergenic
1166104014 19:40588861-40588883 TTGCAGGCTCCTGGGTCAGGTGG - Intronic
1166498940 19:43326960-43326982 TAGCAAGCGCCTGGGGGAGGAGG + Intergenic
1166905792 19:46107507-46107529 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
1166927140 19:46276783-46276805 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
1167046602 19:47053205-47053227 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
1167259620 19:48451021-48451043 AGGCAAACACCTGGGGGAGGCGG - Exonic
1167269193 19:48498434-48498456 AAGGAACCTCCTGGGGGAGAAGG - Exonic
1167270561 19:48503446-48503468 TGGCCTGCTCCTGGGGGAGCAGG + Intronic
1167550631 19:50158247-50158269 TGGTAAGCTTCTGGGGGTGGGGG - Exonic
1167894296 19:52568880-52568902 TAGCATCATCCTGAGGGAGGGGG - Intronic
1167901104 19:52623001-52623023 AAGCAAGATCCTGAGAGAGGAGG - Intronic
1167902150 19:52630024-52630046 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1168212116 19:54898343-54898365 TAGCAAGCTCCTGGGGGAAGAGG + Intergenic
1168227985 19:55010241-55010263 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1168248144 19:55124793-55124815 AAGCAAGATCCTGATGGAGGAGG - Intergenic
1168578104 19:57530355-57530377 TGGCAAGGTACTGGGAGAGGGGG - Intronic
925433855 2:3819361-3819383 AAGCAAGATCCTGGTGGAGAAGG + Intronic
925828818 2:7876119-7876141 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
925854930 2:8120171-8120193 TAGAGAGCTCCTCGGGGAGCAGG + Intergenic
926145336 2:10393771-10393793 AAGCATCCTCCTGGGGTAGGAGG - Intronic
926193522 2:10745778-10745800 TTGCCAGGGCCTGGGGGAGGAGG - Intronic
926407772 2:12572009-12572031 TAGCAAGCTCCTGGGGGATGAGG - Intergenic
926413591 2:12628754-12628776 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
926464091 2:13167448-13167470 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
926815546 2:16795399-16795421 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
928405105 2:31008848-31008870 TAGCTTCCTGCTGGGGGAGGCGG + Intronic
928778305 2:34791960-34791982 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
928928564 2:36601288-36601310 TAGTAAGCTCCTGGGGGAGGAGG - Intronic
929004832 2:37384428-37384450 TAGCAAGCTCTTGTGGGAGGAGG + Intergenic
929076673 2:38084223-38084245 TAGCAAGCTCCTAGGGGAGGAGG + Intronic
929383540 2:41380186-41380208 AAGCAAGATCCTGAGGGAGGAGG - Intergenic
929561403 2:42958743-42958765 GAGCAAGACCCTGGGGGCGGGGG - Intergenic
929684528 2:44022501-44022523 AAGCAAGATCCTGGGGGAGGCGG + Intergenic
929793064 2:45037893-45037915 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
930099079 2:47589125-47589147 AAGCAACATCCTGGGGGAGGAGG + Intergenic
930496879 2:52156607-52156629 CAGCAAGCTCCTGGGTGTGGTGG - Intergenic
930955099 2:57195219-57195241 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
931026392 2:58116873-58116895 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
931042615 2:58315949-58315971 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
931236942 2:60419864-60419886 TAGCAAGCTCCTGGGGAAGGAGG - Intergenic
931608925 2:64078627-64078649 TGGCAAGCTCCTGGGGGAGGAGG + Intergenic
931625777 2:64254781-64254803 TAGCAAGCTCATGGGGGAGGAGG - Intergenic
931850425 2:66246184-66246206 TAGCAAGCTCCTTGGGGAGGAGG - Intergenic
931948258 2:67333850-67333872 TAGCAAGCTCCTGGGGAAGGTGG - Intergenic
932159459 2:69447109-69447131 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
932295854 2:70622880-70622902 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
932358817 2:71088501-71088523 CAGCAAACTCCTGGGGGAGAAGG + Intergenic
932367647 2:71163141-71163163 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
932432115 2:71682348-71682370 TAGCAAGGGCTTGGGGGAGAGGG + Intronic
932573144 2:72948743-72948765 GGGAAGGCTCCTGGGGGAGGTGG + Intronic
932854210 2:75217250-75217272 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
932969102 2:76516857-76516879 TAGCAGGCTCCTGGGGACAGAGG + Intergenic
932973954 2:76577311-76577333 TAGCAAGCTTCTGTGGGAAAAGG + Intergenic
933013092 2:77090629-77090651 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
933079272 2:77967362-77967384 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
933163732 2:79053640-79053662 TAGCAAGCTCCTGGGGAGGGAGG - Intergenic
933179766 2:79215276-79215298 TAGCAAGCTCCTGGGAGAGGCGG + Intronic
933329520 2:80877924-80877946 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
933687823 2:85157537-85157559 CAGCATGGCCCTGGGGGAGGTGG - Intronic
933708584 2:85309101-85309123 CAGCATGCTCCCGTGGGAGGAGG - Exonic
934141263 2:89050172-89050194 AAGCAAGATCCCGGGGGAGGAGG - Intergenic
934227977 2:90150372-90150394 AAGCAAGATCCCAGGGGAGGAGG + Intergenic
934301878 2:91781252-91781274 CAGGAAGTTCCTGGTGGAGGAGG + Intergenic
934572043 2:95379033-95379055 AAGCAAGCTTCTGGGGGACATGG - Intronic
934923715 2:98366782-98366804 TACCGAGCTCCTGGGGAAAGGGG - Intronic
936794293 2:116187726-116187748 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
936870793 2:117132572-117132594 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
936883335 2:117280994-117281016 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
936963829 2:118105821-118105843 TAACCAGCTACTGGGGAAGGCGG - Intronic
939083138 2:137686401-137686423 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
939307413 2:140428392-140428414 TAGCAAGCTCCTGGGGGAGGCGG - Intronic
939460733 2:142493290-142493312 AAGCAAGTTCCTGGGGGAGGAGG + Intergenic
940182940 2:150955292-150955314 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
940530189 2:154869574-154869596 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
940675802 2:156723526-156723548 TAGCAAGCTCCTGGGGAAGGTGG + Intergenic
940726438 2:157341560-157341582 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
940739671 2:157492926-157492948 CAGCAACTTCCTGGAGGAGGTGG - Intergenic
941340400 2:164298108-164298130 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
941353386 2:164461363-164461385 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
941357837 2:164514689-164514711 TAGACAGAACCTGGGGGAGGGGG + Intronic
941456188 2:165713953-165713975 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
941823755 2:169869509-169869531 TATCAATCTGCTGGGTGAGGTGG - Intronic
941935890 2:170981096-170981118 TAGCAAGCTTCTGGGGGAGGCGG + Intergenic
942097086 2:172543991-172544013 TAGCAAGCTTCTGGGGGAGGCGG - Intergenic
942730291 2:179055213-179055235 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
943412931 2:187563936-187563958 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
943421584 2:187673935-187673957 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
943461192 2:188172662-188172684 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
943806652 2:192132676-192132698 TAGCAAGCTCCTGGGGGAAGCGG - Intronic
943835403 2:192509733-192509755 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
943865346 2:192920312-192920334 TAGCAAGCTTCTGGGGGAGAAGG - Intergenic
943951287 2:194134336-194134358 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
944251035 2:197580365-197580387 AAGCAAGATCCTGGGGGAAGAGG - Intronic
944290095 2:197995391-197995413 TAGCAAGCTCCTGGAGCAGGGGG - Intronic
944387450 2:199181625-199181647 AAGCAAGCTCCTGGGGGAGGAGG - Intergenic
944394140 2:199249178-199249200 TAGCCAGCTCCTGGGGGAGGAGG - Intergenic
944573785 2:201071644-201071666 TGGCAGGCTGCTGCGGGAGGCGG - Exonic
945153103 2:206810315-206810337 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
945301484 2:208219694-208219716 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
945361649 2:208901493-208901515 TAGGAAGCTCCTGGGGGAGGCGG - Intergenic
945394301 2:209301476-209301498 TAGCAAGTTCCTGGGGGAGGAGG - Intergenic
945938318 2:215924624-215924646 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
946215030 2:218177489-218177511 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
946245515 2:218385046-218385068 AAGCATACTCCTCGGGGAGGGGG - Intronic
946420229 2:219560723-219560745 AAGCAAGCCCATGGGGGAGGTGG - Intronic
946781044 2:223193298-223193320 TAGCAAGCTCCTGGGGGAGGCGG + Intronic
946886500 2:224227543-224227565 TAGCAAGCTCCTGGGAGAGGAGG - Intergenic
946893274 2:224298928-224298950 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
947540756 2:230976099-230976121 TTGCCAGGGCCTGGGGGAGGGGG + Intergenic
948148950 2:235729471-235729493 CAGCATCCTCCTGGGGGAGGGGG - Intronic
948290466 2:236820435-236820457 AATCCAGCTCCTGGGGGTGGGGG - Intergenic
948323277 2:237088925-237088947 AAGGAAGCTCCTGGAGGTGGCGG + Intronic
948390685 2:237609208-237609230 TAGCAAGTTCCTGGGGGAGGAGG - Intergenic
948988281 2:241539408-241539430 AAGAAAGGTGCTGGGGGAGGAGG + Intergenic
1168839266 20:898796-898818 AAGCAAGATCCTGTGGGAGGAGG - Intronic
1168943279 20:1731200-1731222 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
1169098531 20:2925195-2925217 TTGCCAGCAGCTGGGGGAGGAGG - Intronic
1169131278 20:3167491-3167513 TGGGAAGCTCATGGCGGAGGTGG - Intronic
1169267414 20:4175014-4175036 TAGGAACCTGCAGGGGGAGGAGG - Exonic
1169977175 20:11342811-11342833 GAGGCTGCTCCTGGGGGAGGAGG + Intergenic
1170051646 20:12152362-12152384 TAGCAAGTTGTTGGGGGTGGGGG + Intergenic
1170068864 20:12343733-12343755 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1170106235 20:12756125-12756147 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1170165742 20:13359214-13359236 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1170325487 20:15151291-15151313 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1170680433 20:18521055-18521077 AAGCAAGCTCCTGCGGGAGGAGG + Intronic
1170820701 20:19754603-19754625 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1171557683 20:26092849-26092871 TTCCAAACTCCTGAGGGAGGCGG - Intergenic
1172526254 20:35601980-35602002 GAGCAGGTTCCTAGGGGAGGGGG + Intergenic
1173101912 20:40095601-40095623 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1173118872 20:40271311-40271333 TAGCAATTTCCTGGGGGAGGAGG - Intergenic
1173254955 20:41387632-41387654 GAACAAGCCACTGGGGGAGGTGG - Intergenic
1173507327 20:43598280-43598302 TTGCCAGGGCCTGGGGGAGGTGG + Intronic
1173592033 20:44232182-44232204 TAGCAAGACCCTGGGGCAGAGGG + Intergenic
1174832515 20:53826045-53826067 TGGCAAAGTCCTGGGGCAGGGGG + Intergenic
1175191376 20:57214304-57214326 CTGCAAGCTGCTGGGGCAGGGGG - Intronic
1175642945 20:60646668-60646690 TATCAAGCTGCTGGAGGAGGTGG + Intergenic
1175823683 20:61925087-61925109 TGGCAAGGTCCCGGGGCAGGCGG + Intronic
1176172710 20:63703413-63703435 TGGGAAGTTCCTGGGGGTGGGGG - Intronic
1176653385 21:9569923-9569945 TTCCAAACTCCTGAGGGAGGCGG + Intergenic
1177031172 21:15983249-15983271 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1177063013 21:16396792-16396814 GAGCAACATCCTGGGGGAGGAGG + Intergenic
1177102674 21:16916241-16916263 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1177119566 21:17123746-17123768 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1177132974 21:17279790-17279812 AAGCAGGCTCCTGGGGGTGTGGG + Intergenic
1177382045 21:20356763-20356785 TTGCAAGCTCATGGAGGATGAGG + Intergenic
1178001201 21:28163467-28163489 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1178087381 21:29125620-29125642 AAAGAAGTTCCTGGGGGAGGTGG + Intronic
1178905447 21:36632495-36632517 TAACAAGCTCCTGGAGGATCTGG + Intergenic
1179015281 21:37590468-37590490 TAGCATGCTCCCGGGGGAGGAGG + Intergenic
1179387557 21:40957203-40957225 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1179944714 21:44665332-44665354 TAGCAGACTCCTGGGGCAAGAGG + Intronic
1180091193 21:45534566-45534588 GAGCCAGCTCCTGGTGGAAGAGG - Intronic
1180214768 21:46317123-46317145 GAGCCACCTCCAGGGGGAGGTGG - Intronic
1180308129 22:11146260-11146282 TAGCATGCTCCTGTGGAAAGAGG - Intergenic
1180468419 22:15636629-15636651 CAGCATGCTCCAGGGCGAGGTGG - Intergenic
1180546605 22:16508073-16508095 TAGCATGCTCCTGTGGAAAGAGG - Intergenic
1180814552 22:18781467-18781489 CAGGAAGTTCCTGGTGGAGGAGG - Intergenic
1181200740 22:21215803-21215825 CAGGAAGTTCCTGGTGGAGGAGG - Intronic
1181701001 22:24621170-24621192 CAGGAAGTTCCTGGTGGAGGAGG + Intronic
1182098535 22:27642081-27642103 GAGGAATCTGCTGGGGGAGGGGG - Intergenic
1182113950 22:27744236-27744258 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1182450546 22:30417915-30417937 CATATAGCTCCTGGGGGAGGCGG + Intronic
1182732275 22:32505030-32505052 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1183479955 22:38057981-38058003 TAGTGAGCTCCTGGGAGAGCAGG - Intronic
1183696496 22:39426690-39426712 CAGCAATCTCCTGGGGGAGGGGG - Exonic
1183814778 22:40290603-40290625 GAGAAAGCTCCTAGGGAAGGTGG - Intronic
1184392395 22:44212007-44212029 TGACAAGTTCCTGGGGCAGGTGG - Intronic
1203226176 22_KI270731v1_random:79632-79654 CAGGAAGTTCCTGGTGGAGGAGG + Intergenic
1203264652 22_KI270734v1_random:7154-7176 CAGGAAGTTCCTGGTGGAGGAGG - Intergenic
949162092 3:894126-894148 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
949190395 3:1243269-1243291 TAGCAAGCTCCTGGGGAAGGAGG + Intronic
949671154 3:6399932-6399954 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
949827442 3:8179269-8179291 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
950098428 3:10343354-10343376 TAGAAAGCCCGAGGGGGAGGAGG - Intronic
950144681 3:10640619-10640641 CAGAAAGCTTCTGGAGGAGGAGG + Intronic
950263300 3:11557417-11557439 TTACAAGCTCCCAGGGGAGGTGG - Exonic
950434183 3:12968569-12968591 TAGGAAGAGCCTGGGAGAGGAGG - Intronic
950926496 3:16746570-16746592 TAGCAAGCTCCTGGGGGAGAAGG - Intergenic
951174768 3:19586414-19586436 TGGAAAGCTCCTTGAGGAGGGGG - Intergenic
951239945 3:20275652-20275674 TAGCTAGTTCCTGGGGGATGGGG - Intergenic
951298810 3:20970969-20970991 TAGCAACCTCCTTGGGGAGGAGG + Intergenic
951316315 3:21192656-21192678 TAGCAAGCTCCTGGGGGAGTCGG + Intergenic
951332327 3:21382020-21382042 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
951762795 3:26163827-26163849 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
951888977 3:27551585-27551607 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
952663457 3:35877782-35877804 TAGAAAGCTCCTGGGGGAGGAGG + Intergenic
952896056 3:38079737-38079759 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
953017193 3:39088744-39088766 TAGCAAGGTCCTGGTAGAGCCGG + Intronic
953077134 3:39581257-39581279 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
953177192 3:40563232-40563254 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
953599440 3:44348480-44348502 AAGCAAGATCCTGGGGGAGGAGG + Intronic
953656565 3:44859141-44859163 AAGCAAGCTCCTGTGGGAGGCGG + Intronic
953825700 3:46249748-46249770 TAGCAAGCTCCTCGGGGAGGAGG + Intronic
953841164 3:46391195-46391217 AAGGAAGATCCTGGGGGAGGAGG + Intergenic
954161765 3:48727786-48727808 AAGCAAGATCCTGATGGAGGAGG + Intronic
954385760 3:50243003-50243025 GAGGAAGCAGCTGGGGGAGGAGG + Intronic
954969268 3:54637940-54637962 TAGCAAGTTCCTGGGGGAGGAGG + Intronic
955053180 3:55431942-55431964 TGGGAAGATCCTGGGGGAGGAGG + Intergenic
955253365 3:57305931-57305953 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
955684040 3:61532071-61532093 TTTGAAGCTCTTGGGGGAGGGGG - Intergenic
956233500 3:67042137-67042159 AAGTAAGATCCTGGGGGAGGAGG + Intergenic
956614329 3:71156168-71156190 GAACCAGCTCCAGGGGGAGGGGG + Intronic
956709217 3:72025241-72025263 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
957059900 3:75473489-75473511 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
957155116 3:76536109-76536131 AGGCAAGGTCCTGGGAGAGGAGG + Intronic
957317313 3:78586604-78586626 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
957675252 3:83356578-83356600 AAGTAAGATCCTGGGGGAGGAGG + Intergenic
957904845 3:86541839-86541861 AAGTAAGATCCTGCGGGAGGAGG + Intergenic
957985688 3:87571609-87571631 AAGCAAGATCCTGGGGAAGGAGG - Intergenic
958421954 3:93940053-93940075 AAGCAAGATCCTGGGGGAGGAGG - Intronic
958676812 3:97276442-97276464 TAGCAAGCTCCTGGGAGAGGAGG + Intronic
958751001 3:98193252-98193274 AAGTAAGATCCTGGGAGAGGAGG - Intronic
959026712 3:101247948-101247970 TAGAAGTCTCCTGGAGGAGGGGG - Intronic
959288352 3:104443376-104443398 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
959485775 3:106926187-106926209 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
959972268 3:112421022-112421044 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
960282878 3:115796963-115796985 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
960284228 3:115809417-115809439 TAACAAGTTGCTGGGGGAGATGG - Exonic
960310115 3:116108776-116108798 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
961164763 3:124756010-124756032 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
961293509 3:125865956-125865978 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
961658640 3:128456911-128456933 TGGCAGGCTGCTGGGGGAGAGGG + Intergenic
961730586 3:128961958-128961980 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
961893713 3:130150597-130150619 TAGCAAGCTTCTGGGAGAGGAGG + Intergenic
962146313 3:132843636-132843658 TAGAAAGCCACTGGGGGTGGTGG + Intergenic
962205565 3:133431381-133431403 AAGCAAGCTCCTGGGGGAGGAGG - Intronic
962481404 3:135801564-135801586 CAGCAAGCTCCTTGAGGAGAGGG - Intergenic
962660631 3:137597726-137597748 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
962877152 3:139543705-139543727 TCTCAAGATCCTGGGGTAGGGGG + Intergenic
963058622 3:141207216-141207238 TAGGAAGCTCCTGGGGGAGGCGG - Intergenic
963111841 3:141694744-141694766 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
963319747 3:143799535-143799557 TAGCAAGCTCCTGGATGAGGAGG - Intronic
963425216 3:145115232-145115254 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
963456662 3:145554633-145554655 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
963468613 3:145712650-145712672 TAGCAAGCTCCTAGGGGAGGAGG - Intergenic
963521623 3:146364305-146364327 TAGCAAACTCCTGGGGGAGGTGG - Intergenic
963663343 3:148153903-148153925 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
963684330 3:148416600-148416622 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
964067873 3:152599592-152599614 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
964067897 3:152599695-152599717 TAGCAAGCTCCTGGGGTAGGAGG - Intergenic
964125454 3:153230151-153230173 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
964906514 3:161725319-161725341 TAGCAAGCTTCTAGGGGAGGAGG + Intergenic
964940957 3:162157597-162157619 TAGCAAGCTCCTGGGAGAGGAGG + Intergenic
964983634 3:162714654-162714676 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
964984872 3:162725981-162726003 TAGCAAGCTACTGGGGGAGGAGG + Intergenic
965070328 3:163909795-163909817 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
965105230 3:164345577-164345599 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
965262653 3:166504243-166504265 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
965286733 3:166827561-166827583 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
965624882 3:170675980-170676002 TAGCAAGCTCCTGGGGAAGGTGG + Intronic
965626311 3:170686782-170686804 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
965640040 3:170821416-170821438 TAGCAAGCTCCTGGGGAAGGCGG + Intronic
965713407 3:171578666-171578688 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
965861971 3:173159366-173159388 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
966066844 3:175829966-175829988 TAGCAAGCTCCTGCGGGAAGAGG - Intergenic
966085430 3:176063587-176063609 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
966105086 3:176325081-176325103 CAGCAAGCTCCTGGGGGAGGAGG + Intergenic
966232849 3:177669297-177669319 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
966398449 3:179524391-179524413 AAGCAAGATCCTGATGGAGGAGG + Intergenic
967005365 3:185377990-185378012 TAGCAAGCTCCTGGGGTGGGGGG + Intronic
967212167 3:187178987-187179009 TAGCAAGCTCCTGTGGGAGGAGG + Intronic
967244168 3:187469729-187469751 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
967496220 3:190146757-190146779 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
967561383 3:190922357-190922379 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
967643830 3:191898827-191898849 TAGCAAGCTCCTGGGGGAAGCGG + Intergenic
967658107 3:192074543-192074565 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
967740484 3:192997935-192997957 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
968130120 3:196188403-196188425 TAGGAGGGTCCTAGGGGAGGGGG - Intergenic
968486800 4:866815-866837 GAGGCTGCTCCTGGGGGAGGTGG + Intronic
968993383 4:3929630-3929652 TAGCAAGCTCCTGGGGGAGAAGG - Intergenic
969003813 4:4003674-4003696 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
969435717 4:7188176-7188198 TAGCCAGCACATGGGAGAGGGGG + Intergenic
969654100 4:8486240-8486262 TAGCAAGCTCCTGGGGAAGGTGG + Intronic
969749054 4:9096511-9096533 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
969810114 4:9641151-9641173 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
970029235 4:11657191-11657213 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
970042089 4:11808525-11808547 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
970087547 4:12366014-12366036 TAGCAAGCTCCTGGGGGAGATGG - Intergenic
970256422 4:14173988-14174010 TAGCAAGCTCCTGGGGGACGAGG + Intergenic
970532734 4:16999914-16999936 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
970854048 4:20633757-20633779 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
971123185 4:23725484-23725506 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
971180562 4:24325462-24325484 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
971200139 4:24503259-24503281 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
971552649 4:27976216-27976238 AAGCAAGATCCTGGGGTAGGCGG - Intergenic
972071139 4:35020244-35020266 AAACAAAATCCTGGGGGAGGCGG + Intergenic
972338591 4:38130678-38130700 AGGCAAGACCCTGGGGGAGGTGG + Intronic
973198126 4:47468740-47468762 TAGCAAGATACTGGAGGAAGGGG - Intergenic
973824135 4:54688147-54688169 TAGCATGCAGATGGGGGAGGGGG - Intronic
974428400 4:61767750-61767772 TAGCAAGTTCCTGGGGGAGGAGG + Intronic
975865090 4:78717320-78717342 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
975933889 4:79557439-79557461 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
976696536 4:87924117-87924139 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
976739959 4:88347209-88347231 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
976884573 4:89968254-89968276 TAGCAAGCTCCTCGGGGAGGAGG + Intergenic
977012926 4:91658084-91658106 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
977062510 4:92274952-92274974 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
977075207 4:92442423-92442445 TAGCAAGCTCCTTGGGGAGGAGG + Intronic
977198429 4:94088086-94088108 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
977217156 4:94296677-94296699 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
977225344 4:94386930-94386952 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
977266073 4:94856402-94856424 CAGCAAGAACCTGGGAGAGGGGG + Intronic
977446440 4:97138063-97138085 AAATAAGATCCTGGGGGAGGAGG + Intergenic
977781744 4:100988560-100988582 TAACAAGCTCCTAGGTGATGTGG - Intergenic
978001121 4:103557225-103557247 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
978031482 4:103943390-103943412 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
978187864 4:105879037-105879059 TAGGAAGCTTCTGGAGAAGGAGG - Intronic
978438609 4:108711276-108711298 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
979054624 4:115979115-115979137 TAGGAAGCTCCTGGGGGAGGAGG + Intergenic
979146618 4:117254349-117254371 TAGCAAGCTCCTGGGGAAGGTGG - Intergenic
979379940 4:119996170-119996192 CAGCAAGCTCCTGTGGGAGGAGG - Intergenic
979895159 4:126148598-126148620 TAGCAAGCTCCTGGGGCAGGAGG + Intergenic
980003354 4:127514908-127514930 TAACAAGCTCCTGGGGGAGGAGG + Intergenic
980095701 4:128488251-128488273 CAGCATGCTCCTGGAGGAGTAGG + Intergenic
980111928 4:128644316-128644338 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
980284945 4:130769609-130769631 TAGCAAGTTTCTGGGGGAGGCGG - Intergenic
980388923 4:132120449-132120471 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
980472443 4:133267154-133267176 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
980575638 4:134681368-134681390 TAGCAAGCTACTGGGGGAGGAGG + Intergenic
980611777 4:135170752-135170774 TAGCAAGCTCCTGGGGGATGAGG + Intergenic
980903936 4:138930120-138930142 TAGCAAGCTACTGGGGGAGGAGG - Intergenic
981040242 4:140215743-140215765 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
981482729 4:145255007-145255029 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
981525208 4:145701349-145701371 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
981539723 4:145834994-145835016 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
982069980 4:151686499-151686521 TTGCAAGGTCCCGGGGCAGGGGG - Intronic
982083969 4:151816064-151816086 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
982318808 4:154058529-154058551 AAGCAAGATCCTGAGGGAGGAGG - Intergenic
982396720 4:154922300-154922322 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
982414198 4:155111923-155111945 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
982497106 4:156106928-156106950 TAGCAAGCTCCTGCAGGAGGAGG + Intergenic
982535445 4:156602531-156602553 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
983055486 4:163095337-163095359 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
983202691 4:164879457-164879479 GAGCAAGACCCTGGGGGAGAGGG - Intronic
983345554 4:166522771-166522793 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
983360405 4:166718549-166718571 TAGCAAGATCCTGTGGGAGGAGG - Intergenic
983414710 4:167439266-167439288 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
983448058 4:167878519-167878541 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
983452336 4:167925143-167925165 TAACAAGCTCCTGGGAGAGAAGG - Intergenic
983659570 4:170118703-170118725 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
983707672 4:170679741-170679763 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
983805790 4:171989492-171989514 TAGCAAACTCCTGGGAGAGGAGG + Intronic
983883758 4:172959831-172959853 TAGCAAGCTCCTGGAGGAGGTGG + Intronic
983997671 4:174205331-174205353 ATGCAAACTCCTTGGGGAGGTGG - Intergenic
984099049 4:175464896-175464918 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
984165358 4:176298310-176298332 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
984322186 4:178209371-178209393 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
984393616 4:179168351-179168373 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
984437262 4:179722695-179722717 TAGCAAGCTCCTGGGGAAGGCGG - Intergenic
984700670 4:182816771-182816793 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
984920289 4:184758055-184758077 GAGTGAACTCCTGGGGGAGGGGG - Intronic
985040399 4:185886088-185886110 TAGCAAGCCCCTGGGCGATTGGG + Intronic
985057398 4:186047659-186047681 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
985389871 4:189482925-189482947 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
985435720 4:189928098-189928120 TAGCAAGCTCCTAGTGGGGGCGG - Intergenic
985848970 5:2374683-2374705 TTGCAAGCCCCTGGGTGTGGTGG - Intergenic
986193534 5:5517804-5517826 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
986368981 5:7061772-7061794 AAGCAAGATCCTGATGGAGGAGG + Intergenic
986388878 5:7265834-7265856 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
986502637 5:8416345-8416367 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
986555044 5:9002007-9002029 CAGCAAGCTCCTGGGGGAGGCGG + Intergenic
986905773 5:12492050-12492072 TAGCAAGCTCCTGGGGAAGGAGG - Intergenic
986919588 5:12666001-12666023 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
987282038 5:16422263-16422285 TAGCAAGCTTCTGGGGGAGGAGG - Intergenic
987486834 5:18535924-18535946 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
987487502 5:18540558-18540580 TAGCAATCTCCTGTGGGAGGAGG - Intergenic
987498124 5:18672320-18672342 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
987755830 5:22097093-22097115 TAGCAAGCTCCTGAGGGAGGAGG - Intronic
988199096 5:28047888-28047910 GAGCAAGATCCTGGGGCAGGCGG - Intergenic
988368888 5:30341138-30341160 TATCAAGCTTCTGAGGCAGGTGG - Intergenic
988851834 5:35188119-35188141 TAGCAAGTTCCTGACGGAGCTGG - Intronic
989454188 5:41623010-41623032 TAGCAAGGTCCTGGTTGATGTGG - Intergenic
989659924 5:43788364-43788386 AAGCAAGATTCTGGGGGAGAAGG - Intergenic
990112728 5:52348034-52348056 TAGAAAGGACCTGGGTGAGGGGG - Intergenic
990565126 5:57020442-57020464 AAGCAAGATCCTGCAGGAGGAGG + Intergenic
991509992 5:67365769-67365791 TCGCACTCTCCTGGGGGAAGTGG - Intergenic
992072270 5:73159037-73159059 TAACAAGAGCCTGGGGGTGGTGG - Intergenic
992394660 5:76359603-76359625 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
992836380 5:80645634-80645656 TAGCAAGTTTATGGGGGTGGGGG + Intronic
992960828 5:81955507-81955529 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
993192711 5:84700728-84700750 TAGCAAGCTCTTGTGGGAGGAGG - Intergenic
993836705 5:92826224-92826246 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
994295146 5:98081314-98081336 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
994324873 5:98436817-98436839 AGGCAAGTACCTGGGGGAGGAGG - Intergenic
994532547 5:100987715-100987737 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
994556936 5:101317185-101317207 TAGCAAGCTCCTCGGGGAGGAGG - Intergenic
994778948 5:104067649-104067671 TAGCAAGCTCCTGGGAGAGGAGG + Intergenic
994989551 5:106980629-106980651 TAGCAAGCTCATGGGGGAGGAGG - Intergenic
995125163 5:108571918-108571940 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
995296674 5:110532090-110532112 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
995899367 5:117049826-117049848 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
996052677 5:118950669-118950691 AAGCAAGATCCTGGGGGAGGAGG + Intronic
996203260 5:120701052-120701074 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
996344823 5:122477066-122477088 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
996358625 5:122622329-122622351 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
996509898 5:124306042-124306064 TAGCAAGCTCCTGGGGGTTCTGG - Intergenic
996528052 5:124499303-124499325 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
996745448 5:126843020-126843042 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
996912457 5:128670699-128670721 AGGCAGGCTCCTGGGGGAGGCGG + Intronic
997678866 5:135735136-135735158 AAGCAAGTTCCTTGGGGAGGGGG + Intergenic
997746399 5:136303562-136303584 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
997769682 5:136543074-136543096 AAGCAAGCTCCTATGGGAGGAGG + Intergenic
997772646 5:136568809-136568831 TAAAAAGCTCCTGGGGGAGGAGG + Intergenic
997951019 5:138242496-138242518 CAGCAAGCTACTGGGGGAGGCGG + Intergenic
998693705 5:144614799-144614821 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
998768263 5:145512530-145512552 GACAAAGCACCTGGGGGAGGAGG + Intronic
998995389 5:147865524-147865546 TAGCAAGCTCCTCTGGGAGGAGG - Intergenic
998996398 5:147872434-147872456 TAGGAAGCTCCTGGGAGAGGAGG + Intronic
999618872 5:153453171-153453193 TAGCAAGCTTCTGGGGGAGGAGG + Intergenic
999790018 5:154930674-154930696 TTGCCAGGGCCTGGGGGAGGGGG + Intronic
1000438585 5:161242216-161242238 TAGCAAGCTCCTGGGGGAGATGG - Intergenic
1000439721 5:161250741-161250763 TAGCAAGCTCCTGGGGAAGACGG - Intergenic
1000519407 5:162278838-162278860 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1000606928 5:163336273-163336295 AGGCAAGATCCTGGGGGAGGAGG - Intergenic
1000885323 5:166742552-166742574 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1001331451 5:170765495-170765517 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1001422807 5:171600196-171600218 CAGCAAGCTCCACGGAGAGGGGG - Intergenic
1002104825 5:176874851-176874873 TTGCAAGCTCCTTGGGGCCGGGG - Intronic
1002610962 5:180418187-180418209 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1003430168 6:6031244-6031266 TAGTAAGCTCCTGGGGGAGGAGG + Intergenic
1003495565 6:6660615-6660637 GGACAAGCTCCTGGGGGCGGAGG + Intergenic
1004106265 6:12669626-12669648 TGGCAAGCTCCTGTGGGAGGAGG - Intergenic
1004283525 6:14300413-14300435 TAGCAAGCTCCTCGGGGAGGAGG + Intergenic
1004507998 6:16262454-16262476 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1004575222 6:16888205-16888227 TAGCAAGCTCCTGGAGGAGGAGG - Intergenic
1004768576 6:18757527-18757549 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1005014659 6:21364969-21364991 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1005786576 6:29250668-29250690 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
1005909349 6:30294505-30294527 TGGCAACCTGCTGGGAGAGGTGG + Intergenic
1008084392 6:47229014-47229036 TAACAAGCTCCTGGGTGATGTGG - Intergenic
1008378788 6:50820323-50820345 CGGCAAGCTCCTGGGGGACTCGG + Intronic
1008476524 6:51940432-51940454 TAGTAAGCTCCTGGGGGAGGAGG - Intronic
1008850215 6:56014276-56014298 TAGCAAGCTCCTTGGGGAGGAGG + Intergenic
1009269820 6:61602351-61602373 TAGCAAGATCCTGGGGTAGGCGG - Intergenic
1009343606 6:62588200-62588222 GATCAAGCCCCTGGGGAAGGTGG - Intergenic
1009464335 6:63952155-63952177 AAGCAAGATCCTGATGGAGGAGG - Intronic
1010071726 6:71752009-71752031 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
1010586698 6:77664017-77664039 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1010826914 6:80485899-80485921 TAGCAAACTCCTGGGGGAGGAGG + Intergenic
1010829692 6:80513767-80513789 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1010894547 6:81348599-81348621 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1011704757 6:89989743-89989765 CAGCATCTTCCTGGGGGAGGAGG + Intronic
1011723532 6:90184566-90184588 AAGCAGGCTCCCGGGGGAAGTGG + Intronic
1011770946 6:90673674-90673696 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1012014392 6:93833540-93833562 TAGCAAGCTCCTGCGGGAGGAGG + Intergenic
1012066545 6:94557406-94557428 TAGCAAGCTCCTGCGGGAGGAGG + Intergenic
1012315824 6:97781847-97781869 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1012689573 6:102295174-102295196 TAGCAGGCTGCTGTGGGAGGAGG - Intergenic
1013407890 6:109859217-109859239 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1013641517 6:112087444-112087466 TAGCAAGCTCCCGGAGCCGGCGG - Exonic
1013808087 6:114015774-114015796 AAGCAAGAACCTGGGGGAGGCGG + Intergenic
1013843683 6:114425785-114425807 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1013891701 6:115034129-115034151 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1014360162 6:120465728-120465750 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1014396067 6:120927438-120927460 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1014454873 6:121623901-121623923 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1014555846 6:122842077-122842099 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1014612082 6:123558890-123558912 TGGCAAGGTCCTGGGGGAGGAGG - Intronic
1014614675 6:123585750-123585772 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1014718894 6:124894285-124894307 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1014793993 6:125705323-125705345 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1014891542 6:126851002-126851024 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1015165220 6:130194592-130194614 TAGCAAGCTCCTGGGAGAGGAGG - Intronic
1015266733 6:131297704-131297726 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1015269655 6:131325651-131325673 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1015270933 6:131338338-131338360 TAGAAAGCACCTGGGGTAGGAGG + Intergenic
1015278151 6:131405061-131405083 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1015288043 6:131507744-131507766 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1015323828 6:131903934-131903956 TAGTAAGCTCCTGTGGGAGGAGG - Intergenic
1015823702 6:137289993-137290015 TGGGAAGCTCCTGGGAGAGGAGG - Intergenic
1016033233 6:139359056-139359078 TTAAAAGCTCCTGGGGGAGGGGG + Intergenic
1016114143 6:140260872-140260894 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1016204535 6:141455078-141455100 TAGCAAGCTCCTGGGGAAGGTGG - Intergenic
1016248860 6:142018056-142018078 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1016396388 6:143627950-143627972 TTGCAAGAGTCTGGGGGAGGGGG - Intronic
1016518804 6:144925420-144925442 TAGCAAGCCCCTGGGGGAGGAGG - Intergenic
1016535761 6:145106611-145106633 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1016650292 6:146453877-146453899 TAGCAAGCTCCTGGGGGATGAGG + Intergenic
1016853267 6:148642048-148642070 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1017269813 6:152492462-152492484 AAGCAAGATCCTGGGGGAGAAGG - Intronic
1017389496 6:153923733-153923755 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1017779333 6:157704109-157704131 TAGCAACCTCCTGGGGGAGGAGG + Intronic
1017871236 6:158488488-158488510 TGGCAAGCTCCTTGGAAAGGAGG - Intronic
1018077595 6:160230743-160230765 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1018084498 6:160290033-160290055 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
1018495403 6:164342195-164342217 TAGCAAGCTCCTGGTGGAGGAGG + Intergenic
1018521470 6:164655613-164655635 TAGCAAGCTCCTGGAGGAGGAGG + Intergenic
1019214317 6:170433594-170433616 TGGCAAGCTCATGGGGCAGCCGG + Intergenic
1020142235 7:5618799-5618821 TGGCCAGCGCCTGGGGAAGGTGG + Intergenic
1020323945 7:6960129-6960151 TAGCAAGCTCCTGGGAGAGGCGG + Intergenic
1020532716 7:9356881-9356903 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1020541143 7:9462017-9462039 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1020546082 7:9533138-9533160 TAGCAAGTATTTGGGGGAGGTGG + Intergenic
1020633838 7:10672418-10672440 TACCAAACTCCTGGGGGGAGAGG - Intergenic
1020794213 7:12661815-12661837 AAGCAAGCTCCTGGGGAAGGAGG - Intergenic
1021393622 7:20122851-20122873 TAGCAAGCTTCTGGGGCAGGCGG - Intergenic
1021429847 7:20547697-20547719 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1021637315 7:22705492-22705514 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1021660624 7:22915367-22915389 AAGCAAGATCCTGGGGGATGAGG - Intergenic
1021810662 7:24398525-24398547 TAGCAAGCTCCTGGGGGAAGAGG - Intergenic
1021968926 7:25949305-25949327 TTGAAAGCCACTGGGGGAGGGGG - Intergenic
1021977897 7:26027649-26027671 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1022372871 7:29787095-29787117 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1022447403 7:30481480-30481502 AAGCAAGATCCTGATGGAGGAGG - Intergenic
1022572794 7:31470489-31470511 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
1022710048 7:32841365-32841387 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1022854711 7:34303354-34303376 TAGCAAGTTCCTGGGGGAGGAGG + Intergenic
1023052904 7:36268444-36268466 TAGCAAGCAGCTGGGTAAGGTGG - Intronic
1023368265 7:39486935-39486957 TAGAAAGCCCCTGGTGAAGGCGG + Intronic
1023480027 7:40624206-40624228 GAGGAAGATACTGGGGGAGGAGG - Intronic
1023698888 7:42874069-42874091 TAACAAGTTCCTGGGGGAGGAGG + Intergenic
1024739255 7:52337107-52337129 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
1026740146 7:72974075-72974097 CAGAAAGCGCCTAGGGGAGGTGG + Intergenic
1026791671 7:73336654-73336676 TAGCCAGCTCTCGGGGGAGGTGG - Intronic
1027103587 7:75390995-75391017 CAGAAAGCGCCTAGGGGAGGTGG - Intergenic
1027157885 7:75781401-75781423 AATCAAGATCCTGGGGTAGGAGG - Intronic
1027158314 7:75784177-75784199 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1027354420 7:77341947-77341969 AAGTAAGATCCTGGGGGAGGAGG - Intronic
1027851943 7:83461913-83461935 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1028589912 7:92483250-92483272 AAGCAAGATCCTGGGGGAGGTGG + Intergenic
1028670508 7:93396179-93396201 CAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1028690176 7:93642109-93642131 CAGCAAGCTCCTGGGGGAGGAGG - Intronic
1028747710 7:94346695-94346717 TAGCAAGCTGGAGGAGGAGGAGG + Intergenic
1029108260 7:98195742-98195764 GACGCAGCTCCTGGGGGAGGAGG - Intronic
1029259111 7:99289410-99289432 TAGCAAGCTCAGGGCGGAGAGGG - Intergenic
1029500212 7:100924418-100924440 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1029533561 7:101141858-101141880 TAGCAAGCGGCTGGGCGTGGTGG + Intergenic
1029988455 7:104942107-104942129 GGGCAAGCGTCTGGGGGAGGCGG - Intergenic
1030163610 7:106531863-106531885 TAGCAAGCTCCTGGGGCAGAAGG + Intergenic
1030295884 7:107926636-107926658 CATCATGCTCCTTGGGGAGGTGG - Intronic
1030732715 7:113008944-113008966 TACCAAGATCCTGGAGGAAGGGG - Intergenic
1030751500 7:113237040-113237062 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1031004666 7:116457732-116457754 TAGCAAGCTCCTGGGGGAGGAGG - Intronic
1031355195 7:120780606-120780628 TAGCAAGCTCCTGGGAGAGGAGG + Intergenic
1031364749 7:120889074-120889096 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1031399983 7:121317820-121317842 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1031422457 7:121567441-121567463 TAGCAAGCTCCTGGGGGAGGTGG + Intergenic
1031525590 7:122819169-122819191 TAGCAAGCTCCTGTGGGAGGAGG - Intronic
1031685844 7:124731287-124731309 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1031727934 7:125262364-125262386 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1031776322 7:125912237-125912259 TAGCAAGTTCCTGTGGGAGGAGG - Intergenic
1031777342 7:125919862-125919884 TAGCAAGCTCTTGGGGGAGGAGG - Intergenic
1032391268 7:131556692-131556714 TGGCGGGCTCCTGGGGGAGGGGG - Intronic
1033088555 7:138364799-138364821 AAGCAAGATCCTGGGGGAGGCGG - Intergenic
1033318574 7:140318793-140318815 TAGCAAGGGCCTTGGTGAGGTGG + Intronic
1033442913 7:141396250-141396272 CAGCAAACTCCTGGGAGGGGAGG - Intronic
1033465036 7:141582247-141582269 AAGCAAGTTCCTGGGGGAGGTGG + Intronic
1033613459 7:142987900-142987922 GTCCAGGCTCCTGGGGGAGGTGG + Intergenic
1033625585 7:143107070-143107092 AAGCAAGATCCTGGGGGAGGTGG - Intergenic
1033675953 7:143540684-143540706 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1033695882 7:143788755-143788777 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1033909470 7:146246841-146246863 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1034084834 7:148313512-148313534 TAGCAAGCTCCCGGGGGAGAAGG + Intronic
1034858512 7:154576713-154576735 TACCAGGCTCTTGGGGGAGGAGG + Intronic
1035054191 7:156023023-156023045 TAGGAAGCTCCTGGGTGAGGCGG - Intergenic
1035906190 8:3512567-3512589 AAGTAAGCTCCTGGAGGAGAGGG - Intronic
1036281480 8:7404686-7404708 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1036339989 8:7906886-7906908 TAGCTAGCTCCTGGGGGAGGAGG + Intergenic
1036372130 8:8170855-8170877 TAGCAAGCTCCTGGGGTAGGTGG - Intergenic
1036472332 8:9062897-9062919 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1036639492 8:10573517-10573539 TAGCAAGCTCCTGGGGAAGGTGG - Intergenic
1036878771 8:12494786-12494808 TAGCAAGCTCCTGGGGTAGGTGG + Intergenic
1036966130 8:13300498-13300520 TAGCAGGAGACTGGGGGAGGGGG - Intronic
1037882524 8:22579942-22579964 CAGCCGGCCCCTGGGGGAGGTGG + Intronic
1038316426 8:26488480-26488502 TAACAAGCTCTTTGGGGAAGTGG - Intronic
1039499003 8:38002139-38002161 AAGCAAGATCCTGGGAGAGGAGG + Intergenic
1040387167 8:46921368-46921390 AAGCAAGCCCATGGGAGAGGAGG - Intergenic
1041252351 8:55946749-55946771 TTGCCAGCGGCTGGGGGAGGAGG - Intronic
1041651842 8:60309962-60309984 AAGCAAGATCCTGATGGAGGAGG + Intergenic
1042453555 8:68975420-68975442 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1042494795 8:69443934-69443956 TTGCCAGCAACTGGGGGAGGGGG - Intergenic
1042707367 8:71677160-71677182 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1043353673 8:79389567-79389589 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1043553642 8:81404163-81404185 TTGCATGCTACTGGGGGAGATGG + Intergenic
1043597457 8:81901999-81902021 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
1043717899 8:83508603-83508625 TGGCAAGCTCCTGGGGGAGGAGG + Intergenic
1043720904 8:83546218-83546240 AAGCAAGATCCTGGGGGAGGAGG - Intergenic
1043837735 8:85065221-85065243 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1044258617 8:90093666-90093688 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1044417082 8:91950216-91950238 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1044430499 8:92102207-92102229 TGGGAAGCTCCTGGGTGAGCGGG - Intronic
1044921989 8:97177323-97177345 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1044925156 8:97203167-97203189 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1045197520 8:99946118-99946140 TAGCAAGCTCCTGGGGGAGAAGG - Intergenic
1045644779 8:104288182-104288204 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1046074906 8:109303059-109303081 AAGCAAGATCCTTGGGGAGGCGG - Intronic
1046294117 8:112198071-112198093 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1046386344 8:113512975-113512997 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1046440010 8:114243585-114243607 TCGCAAGCTCCTGGGGGAGGAGG - Intergenic
1046443245 8:114284240-114284262 TAGCAAGTTCCTGTGGGAGGAGG - Intergenic
1046512082 8:115214474-115214496 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1046559281 8:115816856-115816878 TAGCAAGCTCCTGGAGGAGGAGG - Intergenic
1046620882 8:116528477-116528499 GAGAAAGCTGCTGGGGGTGGGGG - Intergenic
1047109099 8:121768804-121768826 CTGCAAGCACATGGGGGAGGTGG - Intergenic
1047615361 8:126558298-126558320 CAGCCAGCTCTCGGGGGAGGTGG + Exonic
1047699344 8:127433976-127433998 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1047829546 8:128615370-128615392 TAGCAAGCTTCTAGGGGAGGAGG + Intergenic
1047856371 8:128916667-128916689 TGGCAAGCTCCTGGGGGAGGCGG - Intergenic
1048143770 8:131821433-131821455 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1048168435 8:132083699-132083721 TAGCAAGCTCCTGTGGGAGGAGG + Intronic
1048184096 8:132223302-132223324 CAGCAAGCCCCTTGAGGAGGAGG - Intronic
1048585422 8:135770603-135770625 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1048728422 8:137411737-137411759 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1048764237 8:137828278-137828300 TAGCAAGCTCCTGGGGGAAGTGG + Intergenic
1048805653 8:138238744-138238766 TACAAAGCTCCCAGGGGAGGTGG + Intronic
1049239141 8:141528085-141528107 AAGCAGGCTCCTGGCGGGGGTGG - Intergenic
1049868821 8:144957721-144957743 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1050060485 9:1704557-1704579 TTGCAAGCTCCTGGGGTACAAGG + Intergenic
1050117600 9:2277815-2277837 TAGCAAGCTCCTGGGGGCGGCGG - Intergenic
1050140479 9:2511682-2511704 AAGCAAGATCCTGTGGGAGGAGG - Intergenic
1050814366 9:9790334-9790356 TCTCAAGCCCCTGGGGAAGGTGG - Intronic
1050896072 9:10887015-10887037 CAGCAAGCTCCTGGGGGAGGTGG - Intergenic
1051052624 9:12950570-12950592 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1051849287 9:21489163-21489185 CAGCAAACTCCTGGGGGAGGAGG + Intergenic
1051953408 9:22662029-22662051 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1052163081 9:25289921-25289943 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
1052191834 9:25671175-25671197 TAGCAAGCTCTTGAGGGTGGAGG - Intergenic
1052374036 9:27697678-27697700 CATCAAGATCCTGGGGAAGGGGG + Intergenic
1052653332 9:31328663-31328685 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1052720643 9:32167973-32167995 CAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1053058030 9:35005737-35005759 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1053078462 9:35154694-35154716 AAGCAAGATCCTGAGGGAAGAGG + Intergenic
1053272107 9:36757244-36757266 TGGAGAGCTCCTGGGGGTGGGGG + Intergenic
1053402748 9:37841141-37841163 TAGCCAGATCCAGGGGCAGGAGG + Intronic
1055233060 9:74087912-74087934 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1055347720 9:75355242-75355264 TGGCAAGCTCCTGGGGGTGGTGG + Intergenic
1055626720 9:78183056-78183078 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
1055810044 9:80139660-80139682 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1055881745 9:81011256-81011278 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1056044739 9:82704173-82704195 TAGCAAGCTCCTAGGGGAGGAGG + Intergenic
1056061157 9:82886006-82886028 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1056319392 9:85422073-85422095 CAGCAACTTCATGGGGGAGGTGG + Intergenic
1056323883 9:85460895-85460917 TCGCAAGCTCCTGGGGGAGGAGG - Intergenic
1056363707 9:85882934-85882956 AGGCAAGATCCTGGGGTAGGTGG - Intergenic
1056522445 9:87413175-87413197 TCGCAAGCTCCTGTGGGAGGAGG - Intergenic
1056568576 9:87796566-87796588 TAGAGAACTCATGGGGGAGGAGG - Intergenic
1056882978 9:90414824-90414846 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1057234844 9:93349854-93349876 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1057377991 9:94542076-94542098 TAGCAAGCTCCTTGGGGAGGAGG - Intergenic
1057423997 9:94934202-94934224 GAGCCAGGTCCTGGTGGAGGAGG - Intronic
1057684000 9:97217092-97217114 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1057812583 9:98269272-98269294 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1057982081 9:99672408-99672430 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1058026209 9:100144155-100144177 TAGCAAGCTTCTTGGGGAGGAGG + Intronic
1058033151 9:100221588-100221610 TAGCAGGTACCTTGGGGAGGAGG - Intronic
1058612400 9:106790446-106790468 TAGCAAGCTCCTGGGGGAGGTGG - Intergenic
1058863512 9:109140437-109140459 GAGCAAGACCCTGGGAGAGGAGG + Intronic
1059546160 9:115178081-115178103 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1059574620 9:115475608-115475630 TAGCAAGCTCCTGGGGAAGGAGG - Intergenic
1059606709 9:115842666-115842688 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1059863488 9:118489135-118489157 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1060107090 9:120879332-120879354 TGGCAACCTCGTGGAGGAGGCGG + Intronic
1060318470 9:122534095-122534117 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1060934251 9:127506435-127506457 CAGCCAGCTCCTGGGTGAGTGGG + Exonic
1061085732 9:128397133-128397155 GAGGCAGATCCTGGGGGAGGAGG + Intergenic
1061139210 9:128754028-128754050 AAGAAAGCTTCAGGGGGAGGAGG - Intronic
1061225824 9:129280547-129280569 TAGAAAGCCCCTTGGGGAGGGGG + Intergenic
1061583066 9:131549335-131549357 TAGCAAGCTCCTGGGGGAAGAGG - Intergenic
1061916950 9:133760245-133760267 TTGGAAGCTCCTGGAGAAGGGGG + Intergenic
1062137796 9:134938868-134938890 CAGCAGGCTCCTGGGGAAGCTGG - Intergenic
1062622696 9:137429838-137429860 TAGCGAGGTCCCGGGGGGGGGGG + Intronic
1203631105 Un_KI270750v1:73370-73392 TTCCAAACTCCTGAGGGAGGCGG + Intergenic
1185846327 X:3441246-3441268 TAGCGAACTCCTGGGGGGAGAGG - Intergenic
1185858431 X:3556585-3556607 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1185960689 X:4543945-4543967 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1185991059 X:4893841-4893863 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1186112866 X:6275639-6275661 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1186745714 X:12566264-12566286 GAGCAAGATCATGGAGGAGGTGG - Intronic
1186784066 X:12942072-12942094 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1187086524 X:16048148-16048170 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1187099959 X:16182618-16182640 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1187626871 X:21124210-21124232 TAGCTAGCTCCAGGATGAGGGGG - Intergenic
1188200969 X:27292604-27292626 AAGCAAGATCCTGAGGGAGGAGG + Intergenic
1188333021 X:28896051-28896073 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1188463375 X:30452555-30452577 TGGCAAGCTCCTTTGGGAGGAGG + Intergenic
1188511121 X:30937604-30937626 TAACAAGCTCCTAGGTGATGTGG - Intronic
1189031814 X:37459229-37459251 AAGCAAGATCCTGATGGAGGAGG + Intronic
1190304766 X:49075744-49075766 TCGCCAGGTCCTGGGGTAGGAGG + Exonic
1191014197 X:55791767-55791789 AAGCAAGATCCTGGGGGAGGCGG + Intergenic
1191775334 X:64807705-64807727 TGTCAAGTTCCTGGGGGAAGTGG + Intergenic
1191942753 X:66498598-66498620 TAGGAAGGTCCTTGGGGAGAAGG + Intergenic
1191976763 X:66881239-66881261 TAAAAAGCTCCAGGGGCAGGAGG - Intergenic
1192369470 X:70501299-70501321 AAGCAAAGTACTGGGGGAGGGGG - Intronic
1192464996 X:71348433-71348455 AAACAAGCTCCTGGGGGATAGGG - Intergenic
1192731521 X:73806371-73806393 AAGCAAGATCCTGGGGGAGGAGG + Intergenic
1192914132 X:75635726-75635748 AAGCAAGATCCTGTGGGAGGAGG + Intergenic
1193941497 X:87684139-87684161 TAGCAAGCTCCTGAGGGAGGAGG - Intergenic
1194058242 X:89164003-89164025 TAGCAGGCTCCTGGGGGGAGGGG - Intergenic
1194186250 X:90776778-90776800 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1194293626 X:92103696-92103718 TAACAAGTTCCTGGGGGAGAAGG + Intronic
1194308542 X:92276519-92276541 TAGCAAGCTCCTGGGGGAGGAGG + Intronic
1194351288 X:92826741-92826763 TAGCAAGCTCCTAGGGGAGGAGG - Intergenic
1194367105 X:93025183-93025205 TAGCAAGCTCCTCGGGGAGGAGG - Intergenic
1194502983 X:94702279-94702301 TAGCAAGCTCCTGGGGGAGGCGG + Intergenic
1194660687 X:96626276-96626298 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1194822769 X:98527731-98527753 TAGCAAGCTCCTGTGGGAGGAGG + Intergenic
1194873801 X:99162897-99162919 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1195291157 X:103432989-103433011 AAGCAAGTTCCTGGGGGAGGTGG + Intergenic
1195301023 X:103530171-103530193 TGGGAAGCTGCTGGGGGTGGGGG - Intergenic
1195326859 X:103765235-103765257 AAGCAAGTTCCTGGTGGAGGTGG + Intergenic
1195841484 X:109180671-109180693 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1195908678 X:109868675-109868697 TAGCAAGCTCCTGGGGAAGGAGG + Intergenic
1196073081 X:111546167-111546189 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1196165543 X:112532866-112532888 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1196220987 X:113112178-113112200 TGGCAAGCTCCTGGGGGAGGAGG + Intergenic
1196227219 X:113180260-113180282 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1196300010 X:114042233-114042255 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1196330823 X:114469013-114469035 TAGCAAGCTCCTGTGGGAGGAGG - Intergenic
1196341717 X:114604762-114604784 TAGCAAGCTCCTGTGGGAGGAGG + Intronic
1196469905 X:116012923-116012945 CAGCAAGATCCTGAGGGATGAGG - Intergenic
1196496863 X:116333073-116333095 TAGCAAGCTCCTGGGGGAGGCGG - Intergenic
1196572498 X:117281409-117281431 TAGCAAGCTCCTGGGGAAGGAGG - Intergenic
1196585124 X:117419913-117419935 TACCAAGCTCCTGGACGAGGAGG - Intergenic
1196992687 X:121346449-121346471 TGGCAAGCTCCTGGGGGAGGAGG + Intergenic
1197064915 X:122224285-122224307 TAGCAAGCTCCTCGGGGAGGAGG - Intergenic
1197352062 X:125392305-125392327 TAGCAAGCTCCTGGGGGAGGGGG + Intergenic
1197470962 X:126865353-126865375 TAGCAAGCTCCTGGGGAGGCAGG - Intergenic
1197499722 X:127228850-127228872 TAGCAAGCTTCTGGGAGAGGCGG - Intergenic
1197793637 X:130279285-130279307 AAGCAAGATCCTGATGGAGGAGG - Intergenic
1197933081 X:131714322-131714344 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1198282892 X:135159776-135159798 TAGCAAGCTGCCTGGGGAAGCGG + Intronic
1198285211 X:135182989-135183011 TAGCAAGCTGCCTGGGGAAGTGG + Intergenic
1198598448 X:138261070-138261092 TAGCAAGTTCCTGGGAAAGGAGG - Intergenic
1198599401 X:138267769-138267791 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1198807648 X:140506186-140506208 GAGCCTGCTCCCGGGGGAGGCGG - Intergenic
1198965922 X:142228800-142228822 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic
1198983756 X:142427025-142427047 TAGCAAGCTCCTGGAGGAGGCGG + Intergenic
1199576480 X:149317916-149317938 TAGCAAGTTCCTCGGGGAGGAGG - Intergenic
1199612345 X:149629249-149629271 TGACAAGGTCCTGGGGTAGGAGG + Intronic
1199765930 X:150941716-150941738 GAGAGAGCTGCTGGGGGAGGGGG + Intergenic
1200523860 Y:4247382-4247404 TACCAAGTTCCTGGGGGAAAGGG + Intergenic
1200532840 Y:4358857-4358879 TAGCAAGCTCCTGGGGGAGGAGG + Intergenic
1200611145 Y:5328242-5328264 TAACAAGTTCCTGGGGGAGGAGG + Intronic
1200659613 Y:5943431-5943453 TAGCAAGCTCCTAGGGGAGGAGG - Intergenic
1200675319 Y:6141439-6141461 TAGCAAGCTCCTCAGGGAGGAGG - Intergenic
1201581389 Y:15514625-15514647 TAGCAAGCTCCTGGGGGAGGAGG - Intergenic