ID: 951888978

View in Genome Browser
Species Human (GRCh38)
Location 3:27551591-27551613
Sequence GCTCCTGGGGGAGGAGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1329
Summary {0: 279, 1: 277, 2: 118, 3: 130, 4: 525}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888971_951888978 1 Left 951888971 3:27551567-27551589 CCAGATCTCTGGCACTTGTAGCA No data
Right 951888978 3:27551591-27551613 GCTCCTGGGGGAGGAGGTTCTGG 0: 279
1: 277
2: 118
3: 130
4: 525
951888969_951888978 15 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888978 3:27551591-27551613 GCTCCTGGGGGAGGAGGTTCTGG 0: 279
1: 277
2: 118
3: 130
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951888978 Original CRISPR GCTCCTGGGGGAGGAGGTTC TGG Intergenic
900102307 1:967057-967079 TCCCCTGCGGGAGGAGGTCCCGG - Intronic
900131220 1:1088180-1088202 GGTCCTGGGGGAGGCCGTTGGGG - Intronic
900148835 1:1169544-1169566 GCCCCTGGAGGAGGAGGGCCAGG - Intergenic
900722541 1:4186698-4186720 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
900840787 1:5047092-5047114 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
900847474 1:5115367-5115389 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
901414198 1:9105638-9105660 GCTCCTGGGAGAGGATGGGCCGG + Exonic
901648529 1:10729279-10729301 CTTCCTGGGGGAGGAGGACCAGG + Intronic
901666773 1:10830630-10830652 GCTCCTGGGGCAGGGGGCGCTGG + Intergenic
901686858 1:10947988-10948010 GCTGCTGGGCGAACAGGTTCTGG + Exonic
902050916 1:13563125-13563147 GATCCTGGGGGAGGCGGTCCTGG - Intergenic
902511843 1:16970860-16970882 GCTCCTGGGGGAGGGGGTTATGG - Intronic
902760398 1:18577074-18577096 GCCCCAGGGGGTGGGGGTTCAGG - Intergenic
902760931 1:18580391-18580413 TTTCCTGGGGGAAGAGGTACTGG + Intergenic
903017876 1:20373448-20373470 GCTCCTGGGGGGACAGGTTTGGG + Intergenic
903033807 1:20481608-20481630 GCCCCTGGGGGAGGAGGGTTTGG - Intergenic
903233885 1:21937376-21937398 GCTCCGGGGAGGGGCGGTTCGGG - Intergenic
903287255 1:22285021-22285043 GCTCCTGGGGGAAGGGGCCCAGG - Intergenic
903396026 1:23002413-23002435 GATCCTGGGGGAGGAGGTCCTGG + Intergenic
903652024 1:24928416-24928438 GCTCCTGGGGGTGGGGGATTTGG - Intronic
904248911 1:29208440-29208462 GCTCCTGGAGGAGGCGAGTCAGG - Intronic
904393959 1:30205637-30205659 AATCCTGGGGGAGGAGGTCCTGG - Intergenic
904567741 1:31437838-31437860 GTTACAGGGGAAGGAGGTTCAGG - Intergenic
904711633 1:32434592-32434614 GCTCTTGGGGGAGGAGGTTCTGG - Intergenic
904996480 1:34635423-34635445 GCTCCTGGGGGAAGAGGTTCTGG + Intergenic
905060520 1:35135796-35135818 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
905499780 1:38427326-38427348 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
905765228 1:40595201-40595223 GCTCCTGGAGAAGGAGGATTGGG + Intergenic
905915506 1:41681731-41681753 GCACCTGAGGGAGGAGGGGCTGG + Intronic
906080922 1:43087753-43087775 GCTCCTGGGAGAGGAGATTCTGG - Intergenic
906115269 1:43352460-43352482 GATCCTGTGGGAGGAGGGGCTGG - Intronic
906177649 1:43789318-43789340 GTTCCTGGGGTTGGAGGTTGGGG + Intronic
906249722 1:44301666-44301688 CCTCCAGGGTGGGGAGGTTCTGG + Intronic
906517836 1:46449914-46449936 TCTTCTGGGGGAAGAGGTTCAGG + Intergenic
907123712 1:52031057-52031079 GCTGTTGGGGGAGGTGGTTTTGG - Intronic
907221109 1:52907497-52907519 CTTCCTGGAGGAGGAGGTACTGG + Intronic
907293603 1:53434491-53434513 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
907485656 1:54776296-54776318 GCTCCTGGGGCCGGAGTCTCTGG - Intergenic
907503567 1:54901326-54901348 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
907521259 1:55024845-55024867 ACTCCTGGGGGAGGAGGTTCTGG - Intergenic
908461715 1:64353433-64353455 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
908591954 1:65645341-65645363 GCTCCTATGGGAGGAGGTTTTGG + Intergenic
908852404 1:68388510-68388532 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
909222660 1:72983298-72983320 GATCCTGGAGGAGGAGGTTCTGG + Intergenic
909223652 1:72991249-72991271 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
909374164 1:74921161-74921183 GATCCTGGGGTAAGAGGTCCTGG - Intergenic
909551019 1:76898239-76898261 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
909776691 1:79492028-79492050 GCTCCTGGGGGAGGATGTTCTGG + Intergenic
909788268 1:79642190-79642212 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
909792977 1:79699809-79699831 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
909909961 1:81247684-81247706 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
909978450 1:82070981-82071003 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
910049381 1:82957561-82957583 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
910144130 1:84058688-84058710 GCTCCTGGGGGAGGAGTTTCTGG + Intergenic
911147986 1:94570324-94570346 GCTCCTGGGGTAAGAGGGTTTGG + Intergenic
911510615 1:98804706-98804728 GCTCCTTGGGGAGGAGGTTCTGG + Intergenic
911570402 1:99511882-99511904 GCTCCTGTGGGAGGAGCTTCTGG - Intergenic
911612297 1:99970231-99970253 GCTCCTGGAGGAGGAGGAAGAGG + Intronic
911759783 1:101601500-101601522 GCTCCTGGGGGAGGTGGGCCTGG + Intergenic
911966928 1:104382432-104382454 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
912296475 1:108475196-108475218 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
912687605 1:111779431-111779453 ACTCTTTGGGGAGGAGGTTCTGG + Intronic
912725732 1:112057485-112057507 GCTCCTGGTGGAGGTGGTGAGGG - Intergenic
912797187 1:112700426-112700448 GCTCCTGGGGGAGGTAGTCATGG - Exonic
912813565 1:112811684-112811706 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
912815308 1:112823933-112823955 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
913245134 1:116864377-116864399 GATCCTGGGGTAGGCGGTCCTGG - Intergenic
913492186 1:119391287-119391309 GATCCTTGGGGAGGGAGTTCTGG - Intronic
913529603 1:119724374-119724396 CCTCCTGCTGGAGGAGGATCTGG + Intronic
913608886 1:120491789-120491811 GCTCCTGGCACAGGAGGTTTGGG + Intergenic
914582307 1:149030049-149030071 GCTCCTGGTACAGGAGGTTTGGG - Intronic
914846503 1:151286679-151286701 GTTCCTGGGAGGGAAGGTTCAGG - Exonic
915520517 1:156439752-156439774 GCTCCTGGGGAGGGAGGGGCAGG - Intergenic
915584136 1:156834778-156834800 GGCTCTGGGGGAGGAGATTCAGG + Intronic
916281733 1:163059061-163059083 CCTGCTGGGGGTGGAGGTTGCGG + Intergenic
918310566 1:183282465-183282487 GCGCCTGGGGCAGGTGGATCAGG - Intronic
918347117 1:183615892-183615914 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
918567671 1:185951765-185951787 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
918714405 1:187768962-187768984 GCTCCTGGGGGAGGAGGTTCAGG + Intergenic
919476399 1:198037038-198037060 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
919506984 1:198411570-198411592 ACTGGTGGGGGAGGAGGTTGGGG - Intergenic
919673302 1:200357423-200357445 TCTGGTGGGGGAGGAGGTTGGGG + Intergenic
919715985 1:200777082-200777104 TCTCCTGAGGGAGTAGGTCCTGG + Intronic
919778540 1:201208881-201208903 GCTCCTGAGGGAATAAGTTCAGG + Exonic
919778667 1:201209394-201209416 GTTTCTGAGGGAGGGGGTTCAGG + Exonic
919778738 1:201209715-201209737 GTTCCTGAGGGAATAGGTTCAGG + Exonic
919778763 1:201209823-201209845 GCTCCTAAGGGAATAGGTTCAGG + Exonic
919778790 1:201209931-201209953 GCTCCTGAGGGAATAGGTTCAGG + Exonic
919778815 1:201210039-201210061 GCTCCTGAGGGAATGGGTTCAGG + Exonic
919778839 1:201210147-201210169 GCTCCTAAGGGAATAGGTTCAGG + Exonic
919778863 1:201210255-201210277 GCTCCTGAGGGAATAGGTTCAGG + Exonic
919778887 1:201210363-201210385 GCTCCTGAGGGAATGGGTTCAGG + Exonic
919778911 1:201210471-201210493 GCTCCTAAGGGAATAGGTTCAGG + Exonic
919778935 1:201210579-201210601 GCTCCTGAGGGAATAGGTTCAGG + Exonic
919778959 1:201210687-201210709 GCTCCTGAGGGAATGGGTTCAGG + Exonic
919779014 1:201210903-201210925 GCTCCTGAGGGAATAGGTTCAGG + Exonic
919779037 1:201211011-201211033 GCTCCTGAGAGAATAGGTTCAGG + Exonic
919779084 1:201211227-201211249 GCTCCTGAGGGAATAGGTTCAGG + Exonic
919779133 1:201211443-201211465 GCTCCTGAGGGAATGGGTTCAGG + Exonic
919786457 1:201261432-201261454 GCTCCTGGTGGGTGGGGTTCTGG - Intergenic
920647126 1:207811981-207812003 GCTCAGGGAGGAGGAGGGTCAGG - Intergenic
920829401 1:209451180-209451202 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
921138685 1:212285482-212285504 GCGCGTGGGGGAGGGGGTTCGGG + Intergenic
921212421 1:212911750-212911772 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
921459779 1:215413409-215413431 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
921509259 1:216010251-216010273 GCTCCTGGAGGAGGAGGTTCTGG - Intronic
921520130 1:216147792-216147814 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
921732973 1:218597258-218597280 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
922048414 1:221968200-221968222 ACTCCTGGGGGAGGAGGTTTTGG - Intergenic
922049532 1:221976572-221976594 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
922154068 1:223027872-223027894 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
922363545 1:224843922-224843944 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
922598975 1:226835512-226835534 GATCCTGGGGCAGGAGGTCCTGG - Intergenic
922877084 1:228948480-228948502 GCTCCTGGGGGAGGAGATTCTGG - Intergenic
922906397 1:229176664-229176686 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
922934823 1:229414629-229414651 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
923030274 1:230243897-230243919 GCTCCTGTGGGAGAGGGTTGTGG + Intronic
923075206 1:230603474-230603496 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
923214193 1:231833676-231833698 GCTCCTGGGGGAGGCAGGCCTGG + Intronic
923244753 1:232120423-232120445 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
923271508 1:232359152-232359174 GATGTTGGGGGAGGAGGTGCTGG + Intergenic
923408622 1:233686901-233686923 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
923770736 1:236935720-236935742 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
924896180 1:248339696-248339718 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1063106408 10:2996447-2996469 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1063127620 10:3149661-3149683 GCTCCTCGGGGAGTGTGTTCAGG + Exonic
1063363167 10:5473356-5473378 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
1063509597 10:6633061-6633083 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1063527680 10:6800558-6800580 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1063538715 10:6910756-6910778 GTTCCTGGGGGATCAGTTTCTGG + Intergenic
1063904799 10:10770457-10770479 GCAGCTGGGGGAGAGGGTTCAGG + Intergenic
1064672999 10:17734732-17734754 GCTTCAGGGAGAGGAAGTTCAGG + Intergenic
1064886993 10:20122626-20122648 GCTCCTGGGGAAGGAGGTTCTGG + Intronic
1065437631 10:25718691-25718713 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1065443120 10:25772206-25772228 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1065918453 10:30370998-30371020 CCTGCTGTGGGAGGAGGTTGGGG + Intronic
1066103396 10:32137122-32137144 GATCCTGGGGGAGGCGGTCCTGG + Intergenic
1066497216 10:35954114-35954136 GCTTCTGAGGGTGGAGGTTAGGG + Intergenic
1066565491 10:36717599-36717621 GCTCCTCCTGGAGGAGGGTCAGG + Intergenic
1067107575 10:43376213-43376235 CCTCCCAGGGGAGGAGGTGCTGG - Exonic
1067133386 10:43586463-43586485 GTCCCTTGGAGAGGAGGTTCTGG + Intergenic
1067360404 10:45573457-45573479 GTTCCTGGGGGAGGAGGTTCTGG - Intronic
1067429554 10:46234117-46234139 GCACCTGGGGGAGCAGGTGATGG + Intergenic
1067998498 10:51303896-51303918 GAACCTGGGGGTGGAGGTTGCGG - Intronic
1068058347 10:52037231-52037253 GCTCCTGTGGGAGGAGGTTCTGG + Intronic
1068179656 10:53502502-53502524 GCTTCTGTGGGAGGAGGTTCTGG + Intergenic
1068230975 10:54169000-54169022 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1068592342 10:58864484-58864506 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1069598135 10:69686110-69686132 GCTCCTGCTGGAGGTGGTTCTGG - Intronic
1069896982 10:71686008-71686030 GCTCCAGGAGGAGGAGGGGCCGG + Intronic
1070152706 10:73814900-73814922 GGTCCTGGGAGAGGAGGTGTGGG - Intronic
1070474928 10:76820814-76820836 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1071598183 10:86942926-86942948 GCTCTTCGGGGAGGAGGTGCTGG - Exonic
1071897731 10:90084507-90084529 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1071916202 10:90297250-90297272 GTTCCTGGGGGAGGAGGTTCTGG - Intergenic
1071961114 10:90809670-90809692 GCTCCTGGCAGAGGAGGTTCTGG - Intronic
1072011276 10:91304954-91304976 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1072580261 10:96734457-96734479 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1073014020 10:100383990-100384012 GATCCTGGGGGAGGCGGTCCTGG - Intergenic
1073709489 10:106021086-106021108 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1074421136 10:113309669-113309691 GCCCCTGTGGGAGGAGGTGGGGG - Intergenic
1074740780 10:116482898-116482920 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1074828526 10:117232012-117232034 GCTGCTGGGGTAGGAGGTGGTGG + Intergenic
1075248699 10:120847093-120847115 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1075343853 10:121668026-121668048 GGTCCTGGGGGAGGTGCTACAGG - Intergenic
1075710095 10:124526223-124526245 GCTCCTGGGGAACGCGCTTCAGG - Intronic
1076095699 10:127733782-127733804 GCTCTTGAGAGAGGAGGTTGGGG + Intergenic
1076303614 10:129447421-129447443 GCTCAGGTGGGTGGAGGTTCAGG + Intergenic
1076721759 10:132396271-132396293 GCGCCTGGGGGAAGGGGGTCCGG + Intergenic
1076839007 10:133036167-133036189 GCCCCTGGGGGAGGCCGCTCAGG - Intergenic
1076982538 11:212533-212555 GCTCCTGGGGGATGTGGTTTCGG + Intronic
1077589876 11:3483101-3483123 GCTCCTGAGAGAGGCGGTTCTGG + Intergenic
1077612185 11:3650180-3650202 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1077679066 11:4222712-4222734 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1077688502 11:4319353-4319375 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1077766382 11:5163751-5163773 GCTCCTGGGGGAGGTGGTTCCGG + Intronic
1077850795 11:6073304-6073326 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1078046123 11:7915628-7915650 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1078215889 11:9311550-9311572 GCTCCTGGGGGAGGAGGACAGGG + Intronic
1078428282 11:11268700-11268722 GCACCTGGTGGAGGTGGTGCTGG + Intergenic
1079230514 11:18645274-18645296 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1079447464 11:20570033-20570055 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1079672570 11:23187406-23187428 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1079727072 11:23890649-23890671 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1079847689 11:25490686-25490708 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
1080027915 11:27632551-27632573 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1080227358 11:29975653-29975675 ACTCGTGGGGGAGGAGGTTCTGG - Intergenic
1080297811 11:30750606-30750628 GCTCCAGTGGCAGGAGCTTCTGG + Intergenic
1080994448 11:37582087-37582109 GATCTTGGGGGATGAGGTCCTGG + Intergenic
1081356807 11:42122820-42122842 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1081677801 11:44981059-44981081 GCTCCTGGGGGAGCTGGTGAGGG + Intergenic
1081869535 11:46377054-46377076 GCTCCTGTGGGGGGAGGTCAGGG - Exonic
1083534411 11:63455154-63455176 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1083681086 11:64352183-64352205 GGTGCTGGAGGAGGAGGTGCGGG + Exonic
1083721289 11:64604843-64604865 GCTCCTGAGGGGTGAGGCTCCGG - Intergenic
1084047170 11:66575863-66575885 GCTCCTGGAGAAGGTGGTTCTGG - Intergenic
1084232304 11:67761928-67761950 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1084245595 11:67854875-67854897 GCTCCTGGGAGAGGCGATTCTGG + Intergenic
1084276470 11:68053883-68053905 GCTCCTGTGGCAGGAGGCTTTGG - Exonic
1084355554 11:68635956-68635978 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1084613273 11:70217744-70217766 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1084827092 11:71739703-71739725 GCTCCTGGGAGAGGCGGTTCTGG - Intergenic
1084857494 11:71998295-71998317 GCCCCTGGGGCAGGAGGTAGGGG + Intergenic
1085934271 11:81124068-81124090 GCTCCTGGATGATGAGGTTCTGG - Intergenic
1085988016 11:81808459-81808481 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1086005019 11:82027465-82027487 GCTCCTGGGGGAGGTGGGCCTGG - Intergenic
1086033926 11:82393984-82394006 ATTCCTAGGGGAGGAGTTTCTGG - Intergenic
1086125305 11:83343551-83343573 GCTCTTGCAGGAGGAGATTCTGG + Intergenic
1086134836 11:83435048-83435070 GCTCCTGGGGGAGGTGGGGTTGG + Intergenic
1086136269 11:83446370-83446392 GCTCCTGGGGGAGGTGGGCCTGG + Intergenic
1087099100 11:94347964-94347986 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1087099643 11:94351897-94351919 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
1087196918 11:95311767-95311789 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1087314676 11:96590169-96590191 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1087839541 11:102907546-102907568 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1088554962 11:111052437-111052459 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
1089108368 11:116034366-116034388 GCTACTGGGGGTGGTGGTGCTGG + Intergenic
1089287999 11:117420013-117420035 CCTCCTGGGGAAGGAGGCTGAGG + Intergenic
1089298253 11:117482248-117482270 TCTCCTGGGGGAGGAGGGCTGGG - Intronic
1089349095 11:117811526-117811548 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1089471053 11:118720466-118720488 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1089697854 11:120226833-120226855 GCGGCAGGCGGAGGAGGTTCGGG + Exonic
1089867048 11:121641391-121641413 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1089987684 11:122829367-122829389 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1090107597 11:123869065-123869087 GCTCCTGGGGGAGGCAGTTCTGG + Intergenic
1090526807 11:127546199-127546221 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
1090546487 11:127772543-127772565 GCTCCTGGGGGAGGCAGTTCTGG + Intergenic
1090662236 11:128890740-128890762 GCTGCAGGGGGAGTAGGTCCAGG - Intergenic
1090850595 11:130567830-130567852 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1091302394 11:134515776-134515798 TCTCCAGGGGGAGGAGGCTCCGG - Intergenic
1091780800 12:3213491-3213513 CCTGGTTGGGGAGGAGGTTCAGG + Intronic
1091781961 12:3219500-3219522 GCTCCTGAGGCAGGAGGTGAAGG - Intronic
1091837354 12:3595182-3595204 GCTGCTGGGGCAGGAGGCTTAGG + Intergenic
1091886518 12:4020775-4020797 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1092416176 12:8292006-8292028 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
1092474489 12:8807182-8807204 GCTCCTGCCGGAGGAGGTTCTGG - Intergenic
1092592753 12:9966534-9966556 GCTCCTGGGGGAGGCAGGCCTGG + Intronic
1092626746 12:10336396-10336418 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1092723718 12:11465637-11465659 GCTCCTGTGGGAGGAGGTTCTGG + Intronic
1092739322 12:11613162-11613184 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1092789710 12:12060637-12060659 GCTCCTCGGGGAGGAGGTTCTGG - Intronic
1092924853 12:13263438-13263460 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1093024332 12:14232824-14232846 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
1093071163 12:14708341-14708363 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1093149384 12:15603378-15603400 GCTGCCAGGGGAGGGGGTTCAGG - Intergenic
1093268009 12:17025171-17025193 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1093321987 12:17723745-17723767 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1093358437 12:18197195-18197217 GCTCCTGGGGAAGGTGGTTCTGG - Intronic
1093578817 12:20765621-20765643 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1093584517 12:20820469-20820491 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1093812835 12:23509479-23509501 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1094316051 12:29138469-29138491 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1094514694 12:31119836-31119858 GCCCGTGGGGGAAGAGGTGCAGG - Intergenic
1094524020 12:31219890-31219912 GCTCCTGGAGGAGGGGGCTAAGG - Intergenic
1094825756 12:34267882-34267904 GCTCCTGGGGGAGAAGGTTCTGG - Intergenic
1095986797 12:48004580-48004602 GCTCCGGGGGCGGGCGGTTCAGG - Intergenic
1095999025 12:48113599-48113621 GATCCTGGGGGAGGCGGTCCTGG + Intronic
1096428500 12:51523927-51523949 GCTGGTGGGGCAGGAGGCTCTGG - Intergenic
1096538451 12:52289835-52289857 GCTGCTGGGTGATGTGGTTCAGG + Intronic
1096540328 12:52303529-52303551 GCTGCTGGGTGATGTGGTTCAGG - Intronic
1096709278 12:53443489-53443511 GCTCCTGGGGGAGGAGGACAGGG - Exonic
1097185283 12:57193348-57193370 GGGCCTGGGGGAGGAGGACCTGG - Intronic
1097398588 12:59104084-59104106 GTTCCTGGGGGAGGAGGTTCTGG - Intergenic
1097417053 12:59326686-59326708 GCTCCTGTTGGAGGAGGTTCTGG + Intergenic
1098173637 12:67770115-67770137 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1098402249 12:70087645-70087667 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1098629060 12:72705594-72705616 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1098630031 12:72712361-72712383 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1098653827 12:73005431-73005453 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1098919906 12:76293704-76293726 GCTCCTTGGGGAGGAGGTCCTGG - Intergenic
1099188715 12:79542104-79542126 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1099292101 12:80786544-80786566 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1099762587 12:86941044-86941066 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1099836098 12:87910858-87910880 GCTCCTGGGGGAGGAGTTCTGGG + Intergenic
1100561360 12:95751421-95751443 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1100940296 12:99717432-99717454 GCTCCTGGGGGAGGCGGGCCTGG - Intronic
1101278398 12:103226147-103226169 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1101865267 12:108515606-108515628 GCTCCTGGGCGGGGCGGTACAGG - Intronic
1102460794 12:113098383-113098405 TGTCCTTGGGGAGGAGGGTCAGG + Intergenic
1102634155 12:114308146-114308168 TCTCCTTGGGGAGGGGGTTTGGG + Intergenic
1103637816 12:122322644-122322666 GCTCCTGGAGCAGGAGGTGGAGG - Intronic
1104072758 12:125360716-125360738 CCTCCTGGAGGAGGAGGCTGTGG + Intronic
1104772666 12:131373140-131373162 GCACCTGGGGGAGGTGATGCAGG - Intergenic
1104789269 12:131471747-131471769 GCTCCTGGGGATGGAGGGGCCGG - Intergenic
1105415790 13:20210442-20210464 GCACCCTGGGGAGGAGGGTCGGG + Intergenic
1106943444 13:34800888-34800910 GCTTCTGTGGGAGGAGGTTCTGG - Intergenic
1107075579 13:36318687-36318709 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1107220294 13:37972643-37972665 GCTCCTGGGGGAGGTAGTTCTGG + Intergenic
1107339955 13:39395438-39395460 GATCCTGGAAGAGGAGGCTCTGG - Intronic
1107683141 13:42870885-42870907 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1108282064 13:48870590-48870612 GATCCTGGGGCAGGCGGTCCTGG + Intergenic
1108355516 13:49625756-49625778 GCTCCTGGGGGTGGGGGAGCTGG - Intergenic
1108500562 13:51066270-51066292 GCACCTCGGGGAGAAGCTTCAGG - Intergenic
1108512996 13:51172112-51172134 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1108814127 13:54269101-54269123 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1108913419 13:55581712-55581734 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1108919545 13:55658441-55658463 GCTCCTATGGGAGGAGGTTCTGG + Intergenic
1108947436 13:56042556-56042578 GCTCATATGGGAGGAGGTTCTGG - Intergenic
1109343582 13:61090601-61090623 GCTCCTGTGGGAGGCGGTTCTGG - Intergenic
1109352918 13:61207032-61207054 GCTCCTGTGGGAGGCGGTTCTGG - Intergenic
1109499294 13:63215368-63215390 GCTCCTAGGGGAGGAGGTTCTGG - Intergenic
1109709666 13:66144804-66144826 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1109716742 13:66229848-66229870 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1110765476 13:79276380-79276402 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1110845342 13:80185917-80185939 GCTCCTGGGGGAGGAGGCTCTGG - Intergenic
1110978491 13:81868419-81868441 GCTTCTGGGGGAGGAGGTTCTGG - Intergenic
1111126043 13:83911748-83911770 GCTCCTGGGGGAAGAGGTTCTGG + Intergenic
1111302048 13:86360651-86360673 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1111362107 13:87189894-87189916 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1111458839 13:88516292-88516314 GCTCCTGGGGGAGGAGATTCTGG + Intergenic
1111630440 13:90841685-90841707 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1111631702 13:90852054-90852076 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1112236828 13:97644561-97644583 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1112324964 13:98437989-98438011 GCGCCTGAGGGAGCACGTTCTGG + Intronic
1112325723 13:98441708-98441730 GCTTTGGGGGAAGGAGGTTCTGG + Intronic
1112434741 13:99383831-99383853 GCTTTTGGGGGAGGAGGGTCTGG + Intronic
1112580700 13:100674592-100674614 GCTGCTGGAGGAGTTGGTTCCGG - Intronic
1112889317 13:104211524-104211546 GCTCTTGGGGGAGGAGGTTCTGG + Intergenic
1113324337 13:109267592-109267614 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1113464802 13:110505676-110505698 GCTCCTCGGGTAGGAGTTACAGG + Intronic
1113711332 13:112467274-112467296 GCTCCTGGGGGAGGAGGTGCGGG - Intergenic
1113810649 13:113140644-113140666 GCTGCTGGGGCAGGGGGTACCGG + Intronic
1113914544 13:113862935-113862957 GCTCCTGCGGGAGGCGGCCCCGG + Intronic
1114031473 14:18584042-18584064 GCTCCTGGGGGCAGAGGTCGCGG + Intergenic
1114219658 14:20684853-20684875 ACTCCTTGGGGAGGAGTTTGCGG + Intronic
1114221677 14:20702828-20702850 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
1114416919 14:22551104-22551126 GACCCTGGGGGAGGAGGGTGCGG - Intergenic
1114522527 14:23348173-23348195 GATGCTGGGGGAGGAGGCCCAGG - Exonic
1114535390 14:23419176-23419198 GCAGCTGGAGGAGGAGGTTAAGG - Exonic
1115240601 14:31248810-31248832 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1115875514 14:37857365-37857387 GCACCTGGGGAAGGAGGTTGGGG + Intronic
1115904808 14:38193036-38193058 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1116179677 14:41518188-41518210 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1116534777 14:46015871-46015893 GCTCCTGGAGGAGGAGTTTCTGG + Intergenic
1116573455 14:46546172-46546194 GCTCTTGGGGGAGGAGGTTCTGG - Intergenic
1116613514 14:47106426-47106448 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1116702404 14:48258849-48258871 GCTCCTGGGGGAGGCGTTTCTGG + Intergenic
1116703291 14:48265841-48265863 GCTCCTGGGGGGGGAGGTTCTGG + Intergenic
1116952913 14:50895416-50895438 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1117174154 14:53130641-53130663 GATCCTGGGGGAGGAGGTCCTGG - Intronic
1117801184 14:59446301-59446323 GCTCCTGGGGGAGGTGGTTCTGG - Intronic
1117957912 14:61136889-61136911 GCTCCTGCGGGAGGTGGGCCTGG + Intergenic
1118466658 14:66037483-66037505 GGTCCTGTAGGAGGAAGTTCTGG - Intergenic
1119022434 14:71126571-71126593 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
1119317202 14:73705736-73705758 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1120251393 14:82064548-82064570 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
1120438051 14:84503672-84503694 GCTCCTGGGGGAGGAGGTTCAGG + Intergenic
1120539559 14:85736440-85736462 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1120618256 14:86733594-86733616 GCTCTTGGGGGAGGAGGTTCTGG - Intergenic
1120659955 14:87238504-87238526 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1121622744 14:95361544-95361566 ACTCCTGGGGGAGGACCTTGGGG + Intergenic
1121703651 14:95975193-95975215 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
1121885675 14:97540539-97540561 GCTGCTGGGTGAGGAAGTCCTGG - Intergenic
1121980580 14:98450591-98450613 GCTCCTAGGGGATGAAGTTCTGG + Intergenic
1122040997 14:98987444-98987466 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1122507637 14:102241873-102241895 GATCCTTGGGGAGGCAGTTCTGG - Intronic
1122694068 14:103544383-103544405 GCTCCTGGGGGAGGGGGCATAGG - Intergenic
1122876531 14:104668738-104668760 GCTGCTGCAGGAGGAGGCTCAGG + Intergenic
1123059546 14:105588290-105588312 GCTCCTGGGGGAAGAAGCCCTGG + Intergenic
1123083885 14:105708560-105708582 GCTCCTGGGGGAAGAAGCCCTGG + Intergenic
1123427469 15:20184041-20184063 GCTCCTGGGGGCAGAGCCTCTGG - Intergenic
1123536705 15:21190591-21190613 GCTCCTGGGGGCAGAGCCTCTGG - Intergenic
1123882493 15:24689046-24689068 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1124925144 15:34063526-34063548 GCTCCTGCGGGAGGATGACCAGG - Exonic
1125045777 15:35241015-35241037 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1125131515 15:36289108-36289130 GCTCCTGGGGGAGGAGTTTCTGG + Intergenic
1125213217 15:37239662-37239684 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1125629221 15:41133753-41133775 GATCCTGGGGGAGGAGGCCCTGG - Intergenic
1125903783 15:43371490-43371512 GCGCCTGGGGGAGTAGGCTGAGG + Intronic
1126332478 15:47548366-47548388 GTTCCAGGGGGAGGTGTTTCTGG - Intronic
1126530153 15:49702603-49702625 GCTCCTGGGGGAGAAGGTTCTGG + Intergenic
1126843748 15:52740832-52740854 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1126912405 15:53430299-53430321 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1127142664 15:55993504-55993526 GCTCCTGGAGGACGAGGTGCGGG - Intronic
1129246771 15:74283653-74283675 CCTCCAGGGGGAGGGGGTTGGGG - Intronic
1129259437 15:74356174-74356196 GATCCTGGGGCAGGTGGTCCTGG - Intronic
1129330291 15:74823652-74823674 CCTCCTGCAGGAGGAGCTTCGGG + Exonic
1129462503 15:75706630-75706652 GCTCCTGGGGGTGGCGATACTGG + Intronic
1129722361 15:77884784-77884806 GCTCCTGGGGGTGGCGATACTGG - Intergenic
1129789512 15:78331434-78331456 GCCCCTGGGGGCTGAGGCTCTGG + Intergenic
1129879609 15:78998121-78998143 GCTCCTGGGTCAGGAGCTCCGGG + Exonic
1130855115 15:87833512-87833534 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1130945944 15:88550968-88550990 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1131060574 15:89401400-89401422 CCTCCTGGAGGAGGAGGCACTGG - Intergenic
1131684181 15:94753019-94753041 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1132263016 15:100442532-100442554 GCTCCTGGGGGAGGCAGTTCTGG - Intronic
1132340413 15:101074782-101074804 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1132472868 16:116440-116462 GCTCCTGGGGTACAGGGTTCTGG - Intronic
1132600940 16:772688-772710 GCTCCTGGGGATGGATGGTCTGG + Exonic
1132645906 16:999171-999193 GCTCCCGGTGGAGCAGCTTCTGG + Intergenic
1132667589 16:1089271-1089293 GCTGCTGGGGGTGGGGGTCCCGG - Intergenic
1132699159 16:1214953-1214975 GCGACTGGGGGTGGAGGGTCGGG - Exonic
1133038368 16:3046834-3046856 GGACCTGGGGGAGGAGATCCGGG - Exonic
1133076444 16:3284085-3284107 TCTCCTGGGGCAGGATGGTCAGG - Exonic
1133126883 16:3652904-3652926 CCCCCTGGGGGAGGAGGGCCTGG - Intronic
1133221835 16:4322183-4322205 GGGCCTGGGGCAGGAGGCTCTGG + Intronic
1133651395 16:7816949-7816971 GCGCCTAGGGCAGGAGGTTCTGG - Intergenic
1133668684 16:7996125-7996147 GGTGCTGGGGGAGGAGGTATTGG + Intergenic
1133765736 16:8836480-8836502 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1133766763 16:8843547-8843569 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1133869543 16:9674580-9674602 TCTCCTGGGGGAGGAGGTTCTGG + Intronic
1133938176 16:10285400-10285422 GCTCCTGGGGGAGGAGGTCGTGG - Intergenic
1134062913 16:11209796-11209818 GCGCCCGAGGGATGAGGTTCAGG - Intergenic
1134134808 16:11671184-11671206 GATGCTGGGGCAGGGGGTTCTGG + Intronic
1134342178 16:13356035-13356057 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1135025414 16:18995596-18995618 GATCCTGGGGGAGGCGGTCCTGG + Intronic
1135223044 16:20630195-20630217 GCTACTGGAGGCGGAGGTTGTGG - Intronic
1136393797 16:29982021-29982043 GCTCTTGGTGGAGGAGGAACTGG - Intronic
1136529951 16:30861402-30861424 GATCCTGGGGGAGGAGGTCCTGG - Intronic
1136585361 16:31180795-31180817 GCGGCTGGGGGCGGAGGCTCGGG + Intronic
1137582300 16:49640798-49640820 GCCCCCGGGGGAGAAGGTGCTGG - Intronic
1138181730 16:54945135-54945157 GCTCCTGGGGCAGAAACTTCTGG - Intergenic
1138395975 16:56705140-56705162 GGTTCTGGGGTATGAGGTTCTGG + Intronic
1138759101 16:59521095-59521117 GCTCCTGGGGAAGGTGGTTCTGG + Intergenic
1138804950 16:60081078-60081100 GCTCCTAGGGGAGGAGGTTCTGG - Intergenic
1139039236 16:62982610-62982632 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1139225915 16:65233299-65233321 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1139230600 16:65278716-65278738 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1139318054 16:66090259-66090281 TCTCCTGGGGGAGGGGAATCAGG - Intergenic
1139424486 16:66870925-66870947 GCTCCTGGCTGAGGTGGGTCTGG - Intronic
1139492935 16:67296478-67296500 TTTCCTGAGGGAGGAGGGTCAGG - Intronic
1139943050 16:70619931-70619953 GCTCCTGTGGGAGGAGGTTCTGG + Intronic
1139943720 16:70624248-70624270 GCTCCTGGGGAAGGAGGTTCTGG + Intronic
1140507262 16:75481688-75481710 GCTCCAGAGGGAGGATGTCCTGG + Intronic
1140770352 16:78198145-78198167 GCTCCTGGGGCAGGTGCCTCTGG + Intronic
1141016908 16:80459378-80459400 GTTCCTGGAGGAGGAGGATAGGG + Intergenic
1141426304 16:83946699-83946721 GCTCCAGGGGGTGGGGGTGCAGG - Intronic
1141683141 16:85555593-85555615 GCTACTGGGTGAGGAGGGGCGGG - Intergenic
1141772870 16:86101616-86101638 GCTCCTGGGGGAAATGGATCGGG - Intergenic
1141772886 16:86101667-86101689 GCTCCTGGGGGAAATGGATCGGG - Intergenic
1141772901 16:86101718-86101740 GCTCCTGGGGGAAATGGGTCGGG - Intergenic
1141772917 16:86101769-86101791 GCTCCTGGGGGAAATGGATCGGG - Intergenic
1141865203 16:86745488-86745510 GGTCCTTGGGGAGGAGGTTCTGG + Intergenic
1141906396 16:87029449-87029471 CCTCCTGGAGGAGGAGGTTTGGG + Intergenic
1142170302 16:88618508-88618530 GCTGCTGGGGTTGGAGTTTCTGG + Intronic
1142345760 16:89553038-89553060 GCTCCTTGGTGAAGAGGTGCTGG - Exonic
1142425537 16:90000460-90000482 GCTCCTGGAGAAGGAAGTACTGG + Intergenic
1142880181 17:2877878-2877900 GCTCCTGGGGGAGACAGTTTGGG + Intronic
1143598412 17:7929287-7929309 CCTCCGGGGGGTGGAGGGTCTGG - Exonic
1144064089 17:11608750-11608772 GCTGCTGGGGGAGGAGAGTCTGG - Intronic
1144104672 17:11974141-11974163 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1144190414 17:12840650-12840672 GTTCCTGGGGGAGCAGCTTAGGG + Intronic
1144735678 17:17554003-17554025 GCTTCTGCGGGAGGAGGCACTGG + Intronic
1144760236 17:17703132-17703154 ACTCCTGGGGGTGGAGGTGCAGG - Intronic
1146597897 17:34185520-34185542 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1147175732 17:38655096-38655118 GCACCTGGGGGAGGAGCAGCTGG + Intergenic
1147184549 17:38706093-38706115 GCTCCTGGAGGAAGAGGTCAAGG + Intronic
1148028660 17:44605293-44605315 TCTCCTGGGGCAGGTGGTCCAGG - Intergenic
1148455337 17:47808263-47808285 GCCCCGGGGGCAGGAGGCTCTGG - Exonic
1148623694 17:49053416-49053438 GCTCCTGGGGGATTAGGGTGTGG + Exonic
1148847729 17:50539004-50539026 GCTGCTGGTGGAGGTGCTTCAGG + Intronic
1149319568 17:55470045-55470067 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
1150005671 17:61467562-61467584 GCTCCTGTGGCAGGAGAATCCGG - Exonic
1150266770 17:63837315-63837337 TCTCCTGGGGGAGAGGGTCCTGG - Intronic
1151338647 17:73455846-73455868 GTGTCTGGGGGAGGAGGTTTGGG - Intronic
1151622490 17:75254820-75254842 GCTCCTGGGGGAGGCAGTTATGG - Intronic
1151784163 17:76266790-76266812 CCTGCTGGGGGAGGAGGGGCAGG + Intronic
1151839755 17:76609418-76609440 GCTCCTGGGGGAGGAGGTTCCGG + Intergenic
1151958562 17:77392998-77393020 GCTCCTGGGGCAGGTGGAGCAGG - Intronic
1152251211 17:79213541-79213563 GACCCTGGGGGAGGAGCCTCTGG - Intronic
1152369591 17:79878091-79878113 GGTCCGGGGGGAGGAGGATGGGG + Intergenic
1152371464 17:79891124-79891146 CTCCCTGGAGGAGGAGGTTCTGG + Intergenic
1152447263 17:80353077-80353099 GCCCCTGGGGGAGCAGGTGGTGG + Intronic
1152832112 17:82503756-82503778 GCACCCGGGGGTGCAGGTTCTGG + Intergenic
1153545767 18:6203640-6203662 GCTCCTAGGGCAGGAGGGACTGG - Intronic
1153665063 18:7360861-7360883 GCCCCTTGGGGAGGAGGCTGAGG - Intergenic
1155173819 18:23286286-23286308 GCTCCTGGGGGAGGCGGTTCTGG - Intronic
1155223983 18:23712299-23712321 GAACCTGGGGGCGGAGGTTGCGG + Intronic
1155697016 18:28696564-28696586 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1155941549 18:31806051-31806073 GCTCCTGGGGGAGGAGATTCTGG - Intergenic
1156237360 18:35218015-35218037 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1156251931 18:35359772-35359794 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1156302248 18:35846140-35846162 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
1156337370 18:36183632-36183654 GGTCCTGGAGGAGGAGGTGGGGG - Intergenic
1156924053 18:42555954-42555976 GCTCCAGGGGGAGGAGGTTCTGG + Intergenic
1156938531 18:42738898-42738920 GCTCCAGGGGGAGGAGGTTCTGG - Intergenic
1156958179 18:42993120-42993142 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1157102889 18:44745824-44745846 GCTCCTGGAGGAGGTGGTGCAGG + Intronic
1157565398 18:48676020-48676042 GGTCCTGGGGGAGGGGGTGCCGG - Intronic
1157663967 18:49469918-49469940 GCTCCTGAGGGAGGAGGAAAGGG - Intergenic
1157906391 18:51573502-51573524 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1158124683 18:54088003-54088025 GCTACTGGGGGTGGAAGTGCAGG + Intergenic
1158336377 18:56417837-56417859 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1158394644 18:57070090-57070112 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1158576696 18:58644445-58644467 GCTCCTGGGGGAGGAGGTCCTGG + Intergenic
1159164467 18:64683887-64683909 GTTCCTGGGGGAGGAGGTTCTGG - Intergenic
1159584723 18:70272839-70272861 GCCCGTGGGGGAGGAAGCTCTGG - Intergenic
1159835052 18:73326883-73326905 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1159891727 18:73959249-73959271 CCTCCTGAGGCAGGAGGTGCAGG - Intergenic
1159929218 18:74294679-74294701 GATCCTGGGGTAGGAGGTCTTGG - Intergenic
1160241204 18:77124497-77124519 GCAGCTGGGGAAGGAGGTGCAGG - Intronic
1160524764 18:79528975-79528997 GCACCTGCGGGTGGAGGCTCCGG + Intronic
1160562864 18:79770549-79770571 GGTCCAGAGGGAGGAGGTGCGGG + Intergenic
1160798105 19:954957-954979 GCCCCTGGGGAGGGAGTTTCCGG + Intronic
1160861054 19:1237397-1237419 GCTCCTGGGGGAGGCGGCTGCGG + Intronic
1160947760 19:1651685-1651707 GCTGCGGGGGGAGGGGGGTCCGG - Intronic
1160996330 19:1883760-1883782 GCTGCTGGGGGAGAATGTCCTGG - Intronic
1161083138 19:2321393-2321415 CCTCCTGGGGGTGAGGGTTCAGG - Intronic
1161090776 19:2359060-2359082 GCTCCTGGGGAAGGCAGGTCAGG - Intergenic
1161299573 19:3536269-3536291 GCTCCTGGGGGATGAGGTCCTGG + Intronic
1161307547 19:3576332-3576354 GCACCTGGGGGAGAAAGGTCTGG + Intronic
1161335081 19:3708646-3708668 GCTCGTGGTGGGGGAGGTTGGGG - Intronic
1161425283 19:4199661-4199683 GCTGCAGGGGGAGGTGGTCCTGG - Exonic
1161661718 19:5550717-5550739 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1161711216 19:5849336-5849358 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1161712040 19:5854356-5854378 GATCCTGGGGCAGGAGGTCCTGG - Intergenic
1162080054 19:8212370-8212392 GCTCATGGGGGAGAAGCTTTAGG + Intronic
1162164465 19:8743073-8743095 GCGCCTGGGGCAGGAGTTCCTGG - Intergenic
1162165537 19:8750541-8750563 GCGCCTGGGGCAGGAGTTCCTGG - Intergenic
1162166602 19:8757997-8758019 GCGCCTGGGGCAGGAGTTCCTGG - Intergenic
1162167668 19:8765453-8765475 GCGCCTGGGGCAGGAGTTCCTGG - Intergenic
1162168607 19:8771751-8771773 GCGCCTGGGGCAGGAGTTCCTGG - Intergenic
1162170353 19:8784515-8784537 GCGCCTGGGGCAGGAGTTCCTGG - Intergenic
1162262211 19:9542482-9542504 GAACCTGAGGGAGGAGGTCCTGG - Intergenic
1162335228 19:10056006-10056028 GTTCCTGAGGGAGGAGGGCCAGG - Intergenic
1162404866 19:10467583-10467605 GCTCCTGGTGGCGGGGGGTCAGG + Exonic
1162558430 19:11402015-11402037 GCTCCTCGGTGAGCTGGTTCTGG + Exonic
1163474616 19:17517691-17517713 GCTCCTTGGGGAGGAAGCCCAGG - Exonic
1163487290 19:17595675-17595697 GCTCCTGGTGGAGGAGGTTCTGG - Intergenic
1163907184 19:20157779-20157801 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1164080804 19:21860033-21860055 GATCCTGGGGAAGGAGGTCCTGG - Intergenic
1164152972 19:22570487-22570509 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1164459230 19:28433326-28433348 GCTTCTGGGGGAGGTGGTGCTGG + Intergenic
1165199735 19:34134215-34134237 GTTCCTGGGTGAGGAGTTTTTGG - Intergenic
1165253618 19:34559349-34559371 GGTCCCGGGGGAGGGGGTGCCGG + Intergenic
1165407967 19:35642305-35642327 GCTCCTGGGGAAGGAGGGAGCGG + Intronic
1165423345 19:35732916-35732938 GGTCCTGGGGATGGAGGTGCTGG + Exonic
1165443566 19:35844427-35844449 GTTCCTGGGGGAGCAGGTGCTGG - Exonic
1165497005 19:36158881-36158903 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1165510318 19:36262947-36262969 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1165835358 19:38751857-38751879 GCTCCTGGGGGAGGCGGTTCTGG - Intronic
1165908050 19:39205598-39205620 GCTCCTGGGGTGGGAGTTGCAGG - Intergenic
1165982648 19:39737757-39737779 GCTCCTGGGGTAGGGGGGTAGGG - Intronic
1166011132 19:39943542-39943564 GCTCCTGGGGGAGGAGGACAGGG + Intergenic
1166112842 19:40633511-40633533 GCTCCTGGAGGAGGAGATGTTGG + Intergenic
1166145660 19:40833147-40833169 GGTCCTGAGGGAGGAAGTTTGGG + Intronic
1166149769 19:40864049-40864071 GGTCCTGAGGGAGGAAGTTTGGG + Intronic
1166373648 19:42315538-42315560 GGTCCTGGGGGAGGAGGGGCTGG + Intronic
1166373678 19:42315613-42315635 GGTCCTGGGGGAGAAGGGGCTGG + Intronic
1166373689 19:42315643-42315665 GTTCCTGGGGGAGGATGGGCTGG + Intronic
1166373708 19:42315681-42315703 GTTCCTGGGGGAGGAGGGGGTGG + Intronic
1166373806 19:42316151-42316173 GGTCCTGGAGGAGGAGGGTCTGG + Intronic
1166498941 19:43326966-43326988 GCGCCTGGGGGAGGAGGTTCTGG + Intergenic
1166905793 19:46107513-46107535 GATCCTGGGGGAGGAGGTCCTGG + Intergenic
1166927141 19:46276789-46276811 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1167046603 19:47053211-47053233 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1167167751 19:47810784-47810806 GGTGCAGGGGGAGGGGGTTCAGG + Intronic
1167249349 19:48392212-48392234 GGATCTGGGGGAGGAGGGTCTGG - Intergenic
1167350168 19:48969387-48969409 GCCGCTGGTGGAGGAGGTGCAGG + Exonic
1167538648 19:50071588-50071610 GCTCCACTGGGAGAAGGTTCTGG + Intergenic
1167749097 19:51369042-51369064 GCCACTGGGGGAGGGGGTTCTGG - Intergenic
1167772387 19:51529525-51529547 GCAGCTTGGGGAGGAGATTCTGG - Intronic
1167793065 19:51692568-51692590 GTTCCTTGGGGAGGAGGGGCCGG + Intergenic
1167902149 19:52630018-52630040 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1167970110 19:53183894-53183916 GGTCCTGGGGGAGCAGGTCAGGG + Intronic
1168212117 19:54898349-54898371 GCTCCTGGGGGAAGAGGTTCTGG + Intergenic
1168227986 19:55010247-55010269 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
925349599 2:3191608-3191630 GTTCCAGAGGAAGGAGGTTCTGG - Intronic
925544554 2:5003226-5003248 GCTCCTGTGGGAGGACGTTCTGG - Intergenic
925828819 2:7876125-7876147 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
926006077 2:9374388-9374410 CTTCCTGGGGGAGGAGGCGCAGG + Intronic
926407771 2:12572003-12572025 GCTCCTGGGGGATGAGGTTCTGG - Intergenic
926413590 2:12628748-12628770 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
926464092 2:13167454-13167476 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
926815547 2:16795405-16795427 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
927488727 2:23506450-23506472 GCTCTTGGGGGATAAGGATCAGG - Intronic
928173986 2:29021969-29021991 GCTCCTGGGGAGGGAGGCCCAGG + Intronic
928778304 2:34791954-34791976 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
928827655 2:35440561-35440583 GCTCCTGGGGGAGGCGTTTCTGG + Intergenic
928857171 2:35815327-35815349 GCTCCTGGGGAAGGCGTTTCTGG - Intergenic
928865883 2:35917306-35917328 TCTCCTATGGGAGAAGGTTCAGG - Intergenic
928928563 2:36601282-36601304 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
929004833 2:37384434-37384456 GCTCTTGTGGGAGGAGGTTCTGG + Intergenic
929076674 2:38084229-38084251 GCTCCTAGGGGAGGAGGTTCTGG + Intronic
929130787 2:38567837-38567859 GCGCCTGGGGGTGGATCTTCTGG + Intronic
929684529 2:44022507-44022529 GATCCTGGGGGAGGCGGTCCTGG + Intergenic
929793065 2:45037899-45037921 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
929828430 2:45328637-45328659 GAGCCTGGAGGAGGAGGTTCTGG - Intergenic
930099080 2:47589131-47589153 CATCCTGGGGGAGGAGGCCCTGG + Intergenic
930487363 2:52025577-52025599 GCTCCTAGGGGAGGCAGTTCTGG + Intergenic
930599333 2:53425080-53425102 GCCCCAGGGGGAGGAGGTCAGGG + Intergenic
930955098 2:57195213-57195235 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
930958379 2:57231135-57231157 GCTCCTGGGGGAGGGAGGCCTGG - Intergenic
931026393 2:58116879-58116901 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
931042614 2:58315943-58315965 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
931236941 2:60419858-60419880 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
931608926 2:64078633-64078655 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
931625776 2:64254775-64254797 GCTCATGGGGGAGGAGGTTCTGG - Intergenic
931850424 2:66246178-66246200 GCTCCTTGGGGAGGAGGTTCTGG - Intergenic
931948257 2:67333844-67333866 GCTCCTGGGGAAGGTGGTTCTGG - Intergenic
932159460 2:69447115-69447137 GCTCCTGGGGGAGGAGGTCCTGG + Intergenic
932295853 2:70622874-70622896 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
932358818 2:71088507-71088529 ACTCCTGGGGGAGAAGGTTCTGG + Intergenic
932367648 2:71163147-71163169 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
932573145 2:72948749-72948771 GCTCCTGGGGGAGGTGGCTGAGG + Intronic
932594950 2:73088002-73088024 GCTCCTTGGGGAGGATGCTGGGG - Intronic
932854211 2:75217256-75217278 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
932973955 2:76577317-76577339 GCTTCTGTGGGAAAAGGTTCTGG + Intergenic
933013091 2:77090623-77090645 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
933079271 2:77967356-77967378 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
933163731 2:79053634-79053656 GCTCCTGGGGAGGGAGGTTCTGG - Intergenic
933179768 2:79215282-79215304 GCTCCTGGGAGAGGCGGGCCTGG + Intronic
933329521 2:80877930-80877952 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
933552393 2:83792373-83792395 GCTCCTGGGGGAGGAGCTTCTGG + Intergenic
933983859 2:87574790-87574812 GTTCCTGGAGGAGGAGTTTCAGG - Intergenic
934141262 2:89050166-89050188 GATCCCGGGGGAGGAGGTCCTGG - Intergenic
934227978 2:90150378-90150400 GATCCCAGGGGAGGAGGTCCTGG + Intergenic
934535691 2:95131376-95131398 GTTCCTGTGGGAGGAGGTACCGG - Intronic
934553403 2:95275529-95275551 GGTGCTGGGGGAGGGAGTTCTGG + Intronic
934738859 2:96704666-96704688 TCTCCTGGGGCTGGAAGTTCTGG - Intergenic
936309995 2:111376004-111376026 GTTCCTGGAGGAGGAGTTTCAGG + Intergenic
936794294 2:116187732-116187754 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
936870792 2:117132566-117132588 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
936883334 2:117280988-117281010 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
937880663 2:126862105-126862127 GAGGCTGGGGGAGGAGGTACTGG - Intergenic
937993897 2:127679196-127679218 GCTCCTGGGGGAGGCATTGCAGG - Intronic
939083139 2:137686407-137686429 GCTCCTGGGGGAGGAGGTTCCGG + Intergenic
939101958 2:137905740-137905762 GAACCTGGGGGTGGAGGTTGCGG - Intergenic
939307411 2:140428386-140428408 GCTCCTGGGGGAGGCGGGCCTGG - Intronic
939460734 2:142493296-142493318 GTTCCTGGGGGAGGAGGCCCTGG + Intergenic
939464078 2:142534817-142534839 GCTGCTGGGGGATGGGATTCAGG - Intergenic
939993425 2:148897970-148897992 GCTCCAGGGAGAGGTGGTGCTGG + Intronic
940107348 2:150114857-150114879 GCTCCTGGGGGAGGCAGGCCTGG - Intergenic
940182939 2:150955286-150955308 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
940216823 2:151311084-151311106 GCTTCTGGGGGAGGGGGTTCTGG - Intergenic
940530188 2:154869568-154869590 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
940675803 2:156723532-156723554 GCTCCTGGGGAAGGTGGTTCTGG + Intergenic
940726439 2:157341566-157341588 GATCCTGGGGGAGGAGGTCCTGG + Intergenic
941340399 2:164298102-164298124 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
941353385 2:164461357-164461379 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
941456189 2:165713959-165713981 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
941935892 2:170981102-170981124 GCTTCTGGGGGAGGCGGGCCTGG + Intergenic
942730292 2:179055219-179055241 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
943412932 2:187563942-187563964 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
943421585 2:187673941-187673963 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
943461194 2:188172668-188172690 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
943806650 2:192132670-192132692 GCTCCTGGGGGAAGCGGGCCTGG - Intronic
943835402 2:192509727-192509749 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
943865345 2:192920306-192920328 GCTTCTGGGGGAGAAGGTTCTGG - Intergenic
943951289 2:194134342-194134364 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
944007381 2:194926473-194926495 CCTCCTGGAAGAGGAGGATCTGG + Intergenic
944387449 2:199181619-199181641 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
944394138 2:199249172-199249194 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
944849804 2:203706648-203706670 GTTCCTCGGGGAGGAGGGGCTGG + Exonic
944876131 2:203965380-203965402 GCTCCTGGGGGAGGAGCTTCTGG + Intergenic
945153104 2:206810321-206810343 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
945173455 2:207019488-207019510 CCTCCTGGGGGAGGAGGTTCTGG - Intergenic
945301485 2:208219700-208219722 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
945311077 2:208314376-208314398 GCTCCTGAGGGAGGAGAATGGGG + Exonic
945361648 2:208901487-208901509 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
945394300 2:209301470-209301492 GTTCCTGGGGGAGGAGGTTCTGG - Intergenic
945600986 2:211864387-211864409 GCTCCAGGTGGAGGAGTTCCTGG - Intronic
945815910 2:214604729-214604751 GAACCTGGGGGCGGAGGTTGTGG - Intergenic
945828230 2:214750652-214750674 CCTCCTGGGGCTGGAGGTTAGGG - Intronic
945858119 2:215091835-215091857 GATCCTGGGGGAGGACGTCCTGG - Intronic
945938317 2:215924618-215924640 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
946215031 2:218177495-218177517 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
946781045 2:223193304-223193326 GCTCCTGGGGGAGGCGGTTCTGG + Intronic
946871755 2:224091314-224091336 GCTCCCGGGGGAAGAGATTTTGG + Intergenic
946886499 2:224227537-224227559 GCTCCTGGGAGAGGAGGCTCTGG - Intergenic
946893273 2:224298922-224298944 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
947665918 2:231905195-231905217 GCTCCTGGGAGAGGAGAGTCTGG - Intergenic
948143750 2:235693102-235693124 ACTCCTTGGGAAGGAGGCTCTGG + Intronic
948154853 2:235773002-235773024 GTTCCTGGTGGAGGGGGTCCAGG + Intronic
948390684 2:237609202-237609224 GTTCCTGGGGGAGGAGGTTCTGG - Intergenic
948420955 2:237859720-237859742 GCTCCTGGGTGAGTAGGTCCAGG + Exonic
948595491 2:239076857-239076879 GATCCAGCGGGAGAAGGTTCAGG - Intronic
948891579 2:240909375-240909397 GCTCCAGGTGGAGGAGGTAGAGG - Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
948988282 2:241539414-241539436 GGTGCTGGGGGAGGAGGACCTGG + Intergenic
1168739345 20:174765-174787 GACTTTGGGGGAGGAGGTTCTGG - Intergenic
1168839265 20:898790-898812 GATCCTGTGGGAGGAGGTCCTGG - Intronic
1169060063 20:2654613-2654635 CATTTTGGGGGAGGAGGTTCTGG + Intronic
1170068865 20:12343739-12343761 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1170106234 20:12756119-12756141 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1170165741 20:13359208-13359230 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1170325488 20:15151297-15151319 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1170680434 20:18521061-18521083 GCTCCTGCGGGAGGAGGTTCTGG + Intronic
1171961339 20:31497059-31497081 TCTCCTGGGAGAGGAGGGGCAGG + Intergenic
1172510096 20:35494571-35494593 GCTGGTGGAGCAGGAGGTTCAGG + Exonic
1172702529 20:36862298-36862320 GAGCCTGGGCGTGGAGGTTCTGG + Intronic
1172957565 20:38771781-38771803 GCTGCTGGTGGAGGTGGTGCTGG + Exonic
1173101911 20:40095595-40095617 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1173118871 20:40271305-40271327 TTTCCTGGGGGAGGAGGTTCTGG - Intergenic
1173320914 20:41986138-41986160 GATCCTGGGTGAGCAGGTCCAGG - Intergenic
1173729135 20:45316667-45316689 GCTCCTGGGGGTGGAGCACCAGG - Exonic
1173809945 20:45949517-45949539 ATTCCTGGGGGAGCAGGTGCTGG + Exonic
1173916887 20:46714485-46714507 GCTCCTTGGGGAGGTGGCACAGG + Intronic
1173961073 20:47073128-47073150 GTTCCTGGGGGTGGGGGTTGCGG - Intronic
1175524275 20:59622773-59622795 GCTGCTGGGGGAGCCGGCTCTGG + Intronic
1176000814 20:62830498-62830520 GGCCCTGGGGAAGGAGGTCCTGG - Exonic
1177031173 21:15983255-15983277 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1177100624 21:16894423-16894445 GCTCCTGGGGGAGGCAGTTCTGG - Intergenic
1177102673 21:16916235-16916257 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1177119565 21:17123740-17123762 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1177161621 21:17554193-17554215 GATCCTGTGGGACCAGGTTCAGG + Intronic
1177840745 21:26231503-26231525 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
1177905276 21:26966235-26966257 GCGGCAGGGGGAGGAGGTGCAGG - Exonic
1178001200 21:28163461-28163483 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1178537140 21:33419902-33419924 GCTCTTGGAGGAGGAGGAGCGGG + Intronic
1178746458 21:35255373-35255395 ACTGCTGGGGGAGGAGGGTTTGG - Intronic
1179015282 21:37590474-37590496 GCTCCCGGGGGAGGAGGTTCTGG + Intergenic
1179387556 21:40957197-40957219 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1179617700 21:42592759-42592781 GGTCCTGGGAGCGGAGGTTCTGG + Intergenic
1179650366 21:42804490-42804512 GCTCCTGGGGGAGGAGTTTCTGG + Intergenic
1179862431 21:44197337-44197359 GGGCCTGGTGGAGGAGGTCCTGG + Intergenic
1180207297 21:46268920-46268942 GCTACTGGGGAGGGAGGCTCAGG + Intronic
1180455585 22:15511099-15511121 GCTCCTGGGGGCAGAGGTCGCGG + Intergenic
1181632366 22:24157868-24157890 GCTGCTGGGAGAGGAGATTAGGG - Intronic
1182113949 22:27744230-27744252 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1182118722 22:27773331-27773353 GCTCCTGGGGAAGCAGATGCTGG + Intronic
1182354561 22:29716731-29716753 CCTGCTGGGGGAGAAGGTACTGG - Intergenic
1182732274 22:32505024-32505046 GCTCCTGGGGGAGGAGGTTCCGG - Intergenic
1182998605 22:34836560-34836582 GCTCTTGGAGGAGGAAGTTCTGG - Intergenic
1183423132 22:37723800-37723822 TCTATTGGGAGAGGAGGTTCTGG - Exonic
1183423147 22:37723869-37723891 TCTACTGGGAGAGGAGGCTCTGG - Exonic
1183423163 22:37723947-37723969 TCTATTGGGAGAGGAGGTTCTGG - Exonic
1183423178 22:37724016-37724038 TCTACTGGGAGAGGAGGCTCTGG - Exonic
1183423194 22:37724094-37724116 TCTATTGGGAGAGGAGGTTCTGG - Exonic
1183423225 22:37724241-37724263 TCTATTGGGAGAGGAGGTTCTGG - Exonic
1183423256 22:37724388-37724410 TCTATTGGGAGAGGAGGTTCTGG - Exonic
1183423303 22:37724601-37724623 TCTGCTGGGAGAGGAGGCTCTGG - Exonic
1183427511 22:37747367-37747389 CCTCCTGGGGGAGGATGAGCAGG + Intronic
1183667730 22:39255046-39255068 GCTGCTGGGGCAGGCAGTTCCGG - Intergenic
1184273973 22:43399910-43399932 CCTCCTGGGGGAGGAAGCCCTGG - Intergenic
1184412050 22:44331374-44331396 GCTCCTGGCGGAGGAGGGTCTGG - Intergenic
1185178511 22:49345911-49345933 TGTCCTGGGGGAGGAGGTTGTGG + Intergenic
1185218788 22:49618407-49618429 GCGCCTGGGGGAGCAGTCTCAGG + Intronic
1185223138 22:49639252-49639274 GCTCCTGGGGAGGGAGGGGCAGG + Intronic
1185226608 22:49657082-49657104 AGTCCTGGGGGAGGAGGTCGGGG + Exonic
949162093 3:894132-894154 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
949190396 3:1243275-1243297 GCTCCTGGGGAAGGAGGTTCTGG + Intronic
949671153 3:6399926-6399948 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
949827441 3:8179263-8179285 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
950548615 3:13653490-13653512 GCTCCAGGGGCAGGAGGTAAGGG + Intergenic
950900262 3:16491225-16491247 GATCCTGGGGGAGGACTTCCAGG + Intronic
950926495 3:16746564-16746586 GCTCCTGGGGGAGAAGGTTCTGG - Intergenic
951298812 3:20970975-20970997 CCTCCTTGGGGAGGAGGTTCTGG + Intergenic
951316316 3:21192662-21192684 GCTCCTGGGGGAGTCGGTTCTGG + Intergenic
951332328 3:21382026-21382048 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
951393965 3:22141659-22141681 GCCCCTGGGGGAGGAGGAGGAGG + Intronic
951762796 3:26163833-26163855 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
951888978 3:27551591-27551613 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
952343561 3:32464873-32464895 GCTCCTGGGGGAGGCAGTTCTGG + Intronic
952358162 3:32603708-32603730 GCTCCTGGTGGAGGTGGTCTGGG + Intergenic
952663458 3:35877788-35877810 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
952896057 3:38079743-38079765 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
953077135 3:39581263-39581285 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
953177191 3:40563226-40563248 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
953656566 3:44859147-44859169 GCTCCTGTGGGAGGCGGTCCTGG + Intronic
953825701 3:46249754-46249776 GCTCCTCGGGGAGGAGGTTCTGG + Intronic
953841165 3:46391201-46391223 GATCCTGGGGGAGGAGGTCCTGG + Intergenic
954391769 3:50271301-50271323 GCTCTTGGGGCAGGAGGGCCTGG - Intronic
954423837 3:50432853-50432875 GCTCCTGGAGAAGGAAATTCTGG + Intronic
954969269 3:54637946-54637968 GTTCCTGGGGGAGGAGGTTCTGG + Intronic
955182303 3:56683350-56683372 GCGCCGGGGGGCGGAGTTTCGGG + Intergenic
955253364 3:57305925-57305947 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
956548989 3:70438326-70438348 GCTCCTGGGGGAGGCAGTTCTGG + Intergenic
956709216 3:72025235-72025257 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
956958801 3:74373989-74374011 GCTCCTGGGGTAGCAGGTAGAGG - Intronic
957295234 3:78326049-78326071 GCTCCTGGGGGAGGAAGTTCTGG - Intergenic
957317314 3:78586610-78586632 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
957577595 3:82029642-82029664 GCTCCTGGCAGAAGAGTTTCTGG - Intergenic
958676813 3:97276448-97276470 GCTCCTGGGAGAGGAGGTTCTGG + Intronic
959288353 3:104443382-104443404 GCTCTTGGGGGAGGAGGTTCTGG + Intergenic
959485776 3:106926193-106926215 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
959880580 3:111440435-111440457 GCTCTAGGGGTAGGAGGTACAGG + Intronic
959972269 3:112421028-112421050 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
960282879 3:115796969-115796991 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
960310116 3:116108782-116108804 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
960616434 3:119600129-119600151 GATCGGGAGGGAGGAGGTTCAGG + Intronic
961143114 3:124572210-124572232 GCTGCTGGGGGTGGAGGTGGGGG + Intronic
961164764 3:124756016-124756038 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
961293508 3:125865950-125865972 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961450515 3:127000322-127000344 GCTGCTGTGGGAGGGGCTTCTGG + Intronic
961711626 3:128832655-128832677 GCTCCTGGGGGAGGCAGTTCTGG + Intergenic
961730585 3:128961952-128961974 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
961881047 3:130061519-130061541 GCTCCTGGGGGAAGATGTTCTGG - Intergenic
961893714 3:130150603-130150625 GCTTCTGGGAGAGGAGGTTCTGG + Intergenic
962205564 3:133431375-133431397 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
962318152 3:134371379-134371401 GCTCCTGGATGAGGCGGTGCAGG + Exonic
962838030 3:139205951-139205973 GCTCCTTGGTGAGGAGGGTCTGG - Intronic
963058620 3:141207210-141207232 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
963111842 3:141694750-141694772 GATCCTGGGGGAGGAGGTCCTGG + Intergenic
963319746 3:143799529-143799551 GCTCCTGGATGAGGAGGTTCTGG - Intronic
963425215 3:145115226-145115248 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
963456663 3:145554639-145554661 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
963468612 3:145712644-145712666 GCTCCTAGGGGAGGAGGTTCTGG - Intergenic
963521622 3:146364299-146364321 ACTCCTGGGGGAGGTGGTTCTGG - Intergenic
963567551 3:146948359-146948381 GCTCCTGGGTGAGGAGAGTGTGG + Intergenic
963663342 3:148153897-148153919 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
963684329 3:148416594-148416616 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
963866367 3:150366434-150366456 GCTACTGGAGGAGGGGGTTGAGG - Intergenic
964067872 3:152599586-152599608 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
964067896 3:152599689-152599711 GCTCCTGGGGTAGGAGGTTCTGG - Intergenic
964125456 3:153230157-153230179 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
964300255 3:155278646-155278668 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
964906515 3:161725325-161725347 GCTTCTAGGGGAGGAGGTTCTGG + Intergenic
964940958 3:162157603-162157625 GCTCCTGGGAGAGGAGGTTCTGG + Intergenic
964983633 3:162714648-162714670 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
964984873 3:162725987-162726009 GCTACTGGGGGAGGAGGTTCTGG + Intergenic
965070327 3:163909789-163909811 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
965105231 3:164345583-164345605 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
965262654 3:166504249-166504271 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
965286734 3:166827567-166827589 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
965336327 3:167433461-167433483 GCTCCTGGGGGAGGCAGTTCTGG - Intergenic
965624883 3:170675986-170676008 GCTCCTGGGGAAGGTGGTTCTGG + Intronic
965626312 3:170686788-170686810 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
965640041 3:170821422-170821444 GCTCCTGGGGAAGGCGGTTCTGG + Intronic
965713406 3:171578660-171578682 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
965861972 3:173159372-173159394 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
966066843 3:175829960-175829982 GCTCCTGCGGGAAGAGGTTCTGG - Intergenic
966085429 3:176063581-176063603 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
966105087 3:176325087-176325109 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
966232850 3:177669303-177669325 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
966279301 3:178209778-178209800 GCTCCTGGGGGAGGCAGGCCTGG - Intergenic
966599513 3:181761339-181761361 GTTCCTGGGTGAGGTGGCTCAGG - Intergenic
967212168 3:187178993-187179015 GCTCCTGTGGGAGGAGGTTCTGG + Intronic
967244169 3:187469735-187469757 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
967496219 3:190146751-190146773 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
967561382 3:190922351-190922373 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
967643831 3:191898833-191898855 GCTCCTGGGGGAAGCGGTTCTGG + Intergenic
967658108 3:192074549-192074571 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
968731559 4:2271581-2271603 CCTCCTGGGGGAGGGGCTGCAGG - Intronic
968950397 4:3688518-3688540 GGCCCTGAGGGAGGAGGTGCAGG + Intergenic
968993382 4:3929624-3929646 GCTCCTGGGGGAGAAGGTTCTGG - Intergenic
969003814 4:4003680-4003702 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
969499689 4:7545184-7545206 GTTCCAGGGGCAGGAGATTCAGG - Intronic
969654101 4:8486246-8486268 GCTCCTGGGGAAGGTGGTTCTGG + Intronic
969713043 4:8855365-8855387 GCTCCTTGGGGACAAGATTCAGG - Intronic
969749053 4:9096505-9096527 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
969810113 4:9641145-9641167 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
970029236 4:11657197-11657219 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
970042088 4:11808519-11808541 GCTCCTGGGGGAGGCGGCTCTGG - Intergenic
970087546 4:12366008-12366030 GCTCCTGGGGGAGATGGTTCTGG - Intergenic
970167127 4:13250608-13250630 GCTCATGAGGGTGGAAGTTCAGG - Intergenic
970256423 4:14173994-14174016 GCTCCTGGGGGACGAGGTTCTGG + Intergenic
970532733 4:16999908-16999930 GCTCCTGGGGGAGGCGGCTCTGG - Intergenic
970854049 4:20633763-20633785 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
971552648 4:27976210-27976232 GATCCTGGGGTAGGCGGTCCTGG - Intergenic
972071140 4:35020250-35020272 AATCCTGGGGGAGGCGGTCCTGG + Intergenic
972598062 4:40547607-40547629 GGTCCTGGGAGATGAGGTTGGGG - Intronic
973293214 4:48490297-48490319 GGCCCTGGGGGACGAGGTGCTGG + Exonic
974428401 4:61767756-61767778 GTTCCTGGGGGAGGAGGTTCTGG + Intronic
975434338 4:74334214-74334236 GCTGCAGCGGGAGCAGGTTCTGG - Intergenic
975865091 4:78717326-78717348 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
975933890 4:79557445-79557467 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
976281950 4:83334641-83334663 GCTCCTGGGTGAAGAAGTCCAGG + Exonic
976696535 4:87924111-87924133 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
976884574 4:89968260-89968282 GCTCCTCGGGGAGGAGGTTCTGG + Intergenic
977062511 4:92274958-92274980 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
977075208 4:92442429-92442451 GCTCCTTGGGGAGGAGGTTCTGG + Intronic
977198430 4:94088092-94088114 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
977217157 4:94296683-94296705 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
977225345 4:94386936-94386958 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
978001122 4:103557231-103557253 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
978031480 4:103943384-103943406 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
978303231 4:107293888-107293910 GATCCTGGGGGAGGCAGTCCTGG + Intergenic
978438608 4:108711270-108711292 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
979054625 4:115979121-115979143 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
979146617 4:117254343-117254365 GCTCCTGGGGAAGGTGGTTCTGG - Intergenic
979379939 4:119996164-119996186 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
979850309 4:125565104-125565126 GCTCCTGTGCTAGGAGATTCTGG + Intergenic
979895160 4:126148604-126148626 GCTCCTGGGGCAGGAGGTTCTGG + Intergenic
980003355 4:127514914-127514936 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
980111930 4:128644322-128644344 GCTCCTGGGGGAGGTGGGCCTGG + Intergenic
980284944 4:130769603-130769625 GTTTCTGGGGGAGGCGGTTCTGG - Intergenic
980388922 4:132120443-132120465 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
980472444 4:133267160-133267182 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
980527867 4:134014417-134014439 GTTCCTGGGGGAGGCAGTTCTGG - Intergenic
980575639 4:134681374-134681396 GCTACTGGGGGAGGAGGTTCTGG + Intergenic
980611778 4:135170758-135170780 GCTCCTGGGGGATGAGGTTCTGG + Intergenic
980903935 4:138930114-138930136 GCTACTGGGGGAGGAGGTTCTGG - Intergenic
980916985 4:139042834-139042856 GAACCTGGGGGTGGAGGTTGCGG + Intronic
981040241 4:140215737-140215759 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
981525207 4:145701343-145701365 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
981539722 4:145834988-145835010 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
982083970 4:151816070-151816092 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
982318807 4:154058523-154058545 GATCCTGAGGGAGGAGGTCCTGG - Intergenic
982353726 4:154444362-154444384 GCACCTGGGGGAAGAGGTTTAGG - Intronic
982396721 4:154922306-154922328 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
982414199 4:155111929-155111951 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
982497107 4:156106934-156106956 GCTCCTGCAGGAGGAGGTTCTGG + Intergenic
982535444 4:156602525-156602547 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
983055485 4:163095331-163095353 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
983345553 4:166522765-166522787 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
983360404 4:166718543-166718565 GATCCTGTGGGAGGAGGTTCTGG - Intergenic
983414711 4:167439272-167439294 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
983448057 4:167878513-167878535 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
983452335 4:167925137-167925159 GCTCCTGGGAGAGAAGGTTCTGG - Intergenic
983659569 4:170118697-170118719 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
983707671 4:170679735-170679757 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
983796969 4:171875811-171875833 GCACCTGGGGGAGGAAGCTCTGG - Intronic
983805791 4:171989498-171989520 ACTCCTGGGAGAGGAGGTTCTGG + Intronic
983883760 4:172959837-172959859 GCTCCTGGAGGAGGTGGGCCTGG + Intronic
984099050 4:175464902-175464924 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
984165359 4:176298316-176298338 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
984322184 4:178209365-178209387 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
984411725 4:179405461-179405483 GATCCTGGGGGAGGCAGTCCCGG - Intergenic
984437260 4:179722689-179722711 GCTCCTGGGGAAGGCGGGCCTGG - Intergenic
984700669 4:182816765-182816787 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
985057399 4:186047665-186047687 GCTCTTGGGGGAGGAGGTTCTGG + Intergenic
985239129 4:187910967-187910989 GCTCCTCAGGGAGGATATTCTGG + Intergenic
985389872 4:189482931-189482953 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
985545035 5:505171-505193 GCTGCTGTGGGAGGAGCATCTGG + Intronic
985894180 5:2739314-2739336 GGTCCTGGGGGCGGCGGTGCCGG + Intergenic
985959332 5:3287810-3287832 GCTCCTGGAGCAGGAGGCTGGGG + Intergenic
986193533 5:5517798-5517820 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
986306319 5:6519649-6519671 GCTCCGGGTAGAGGATGTTCTGG - Intergenic
986388877 5:7265828-7265850 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
986502636 5:8416339-8416361 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
986555045 5:9002013-9002035 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
986905772 5:12492044-12492066 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
986919589 5:12666007-12666029 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
987282037 5:16422257-16422279 GCTTCTGGGGGAGGAGGTTCTGG - Intergenic
987448481 5:18051958-18051980 GCACCTGGGGGAGGTGGTAAGGG - Intergenic
987486833 5:18535918-18535940 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
987487501 5:18540552-18540574 TCTCCTGTGGGAGGAGGTTCTGG - Intergenic
987498125 5:18672326-18672348 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
987755829 5:22097087-22097109 GCTCCTGAGGGAGGAGGTTCTGG - Intronic
988030638 5:25758937-25758959 GTCCCTGGGGTAGGAGATTCAGG - Intergenic
989659923 5:43788358-43788380 GATTCTGGGGGAGAAGGTCCTGG - Intergenic
989688903 5:44118202-44118224 GATCCTGGGGGAGGAGTTCCTGG + Intergenic
989780687 5:45262000-45262022 GCTGCTGGTGGAGGGGGTGCTGG + Exonic
991099574 5:62777736-62777758 GGTCCTGGGGGAGGTGGATCAGG - Intergenic
992141148 5:73798479-73798501 GCTCCTTGCGGAGCTGGTTCTGG - Intronic
992394659 5:76359597-76359619 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
992452004 5:76883851-76883873 GCTCCTGGGGAAGGAGTTTCTGG + Intronic
992960827 5:81955501-81955523 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
993192710 5:84700722-84700744 GCTCTTGTGGGAGGAGGTTCTGG - Intergenic
993836704 5:92826218-92826240 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
994295145 5:98081308-98081330 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
994375788 5:99014775-99014797 ACTCCTGGGGGAGGAGCTTCTGG + Intergenic
994532548 5:100987721-100987743 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
994556935 5:101317179-101317201 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
994775682 5:104033860-104033882 GCTCCTGGGGGAGGAGATTCTGG - Intergenic
994778949 5:104067655-104067677 GCTCCTGGGAGAGGAGGTTCTGG + Intergenic
994989550 5:106980623-106980645 GCTCATGGGGGAGGAGGTTCTGG - Intergenic
995296673 5:110532084-110532106 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
995769381 5:115652774-115652796 TCTCCTGGGGGAGGCAGTCCTGG - Intergenic
995899368 5:117049832-117049854 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
996203261 5:120701058-120701080 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
996344824 5:122477072-122477094 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
996358626 5:122622335-122622357 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
996528051 5:124499297-124499319 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
996575000 5:124970064-124970086 CAAGCTGGGGGAGGAGGTTCTGG + Intergenic
996745449 5:126843026-126843048 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
996750078 5:126879432-126879454 GGTCCTAAGTGAGGAGGTTCAGG - Intronic
996912459 5:128670705-128670727 GCTCCTGGGGGAGGCGGGCCTGG + Intronic
997198017 5:131992476-131992498 GCTCCTGGGGGATGAGGCAAGGG + Intronic
997246127 5:132351146-132351168 GATCATGGGGGAGGAGGTGATGG - Intergenic
997452967 5:133998256-133998278 GCTTCTGGAGAAGGAGGTTTAGG + Intronic
997678867 5:135735142-135735164 GTTCCTTGGGGAGGGGGTCCTGG + Intergenic
997746398 5:136303556-136303578 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
997769683 5:136543080-136543102 GCTCCTATGGGAGGAGGTTCTGG + Intergenic
997772647 5:136568815-136568837 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
998693706 5:144614805-144614827 GCTCTTGGGGGAGGAGGTTCTGG + Intergenic
998891783 5:146753927-146753949 TCTCCTGAGGGATGAGCTTCTGG + Intronic
998995388 5:147865518-147865540 GCTCCTCTGGGAGGAGGTTCTGG - Intergenic
998996399 5:147872440-147872462 GCTCCTGGGAGAGGAGGTTCTGG + Intronic
999539543 5:152556664-152556686 GCTCCTGGGCTAGGGGGTTCTGG - Intergenic
999618873 5:153453177-153453199 GCTTCTGGGGGAGGAGGTTCTGG + Intergenic
999870667 5:155747025-155747047 GCCCCTGGAGGAGGAAGCTCTGG - Intergenic
1000438583 5:161242210-161242232 GCTCCTGGGGGAGATGGGCCTGG - Intergenic
1000519408 5:162278844-162278866 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1000606927 5:163336267-163336289 GATCCTGGGGGAGGAGGTCCTGG - Intergenic
1000885324 5:166742558-166742580 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1000935644 5:167301355-167301377 GCTCCTGGGGGAGGCAGTTCTGG + Intronic
1001331452 5:170765501-170765523 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1002087387 5:176784744-176784766 GCTGCTGGGGGAGGAGTCCCAGG + Intergenic
1002089231 5:176794650-176794672 GCTGCTGGGGAAGGAGGGCCGGG - Intergenic
1002495632 5:179609515-179609537 GCTCCTGAGGACGGACGTTCAGG - Exonic
1002610963 5:180418193-180418215 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1003187900 6:3849170-3849192 GATCCTGGAGGAGGCGCTTCTGG - Intergenic
1003525169 6:6891183-6891205 GCTGCTGGGGGAGGAGGCAGCGG + Intergenic
1003618095 6:7673244-7673266 GCCCCTGTGGGAGGAGGGTGGGG + Intergenic
1004106264 6:12669620-12669642 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1004283526 6:14300419-14300441 GCTCCTCGGGGAGGAGGTTCTGG + Intergenic
1004507999 6:16262460-16262482 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1004575221 6:16888199-16888221 GCTCCTGGAGGAGGAGGTTCTGG - Intergenic
1004760054 6:18656511-18656533 GCTCCTGGGGGAGGGGCAACTGG + Intergenic
1004768577 6:18757533-18757555 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1004837000 6:19541147-19541169 GCTCCTGGGGGAGGATGTTCTGG - Intergenic
1005014660 6:21364975-21364997 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1005671667 6:28112595-28112617 GGTTCTGGGGGAGGAGGTGCAGG - Intergenic
1005689042 6:28284089-28284111 GCTCCTTGGGCAGGATGGTCAGG - Exonic
1005786577 6:29250674-29250696 GATCCTGGGGGAGGAGGTCCTGG + Intergenic
1005992505 6:30912164-30912186 GCCCCTGGAAGAGGAGGTTGGGG + Intronic
1006026458 6:31150247-31150269 GCTCCTGGGGGAGGAGAGGAAGG + Intronic
1006297918 6:33178268-33178290 GGTGCTGGGGGAGGGGGCTCTGG - Intronic
1006813665 6:36837012-36837034 CTTCCTGGGGGATGTGGTTCTGG - Intronic
1006837172 6:37005973-37005995 GCCCCTGCAGGAGGAGGGTCCGG - Intronic
1007167795 6:39841081-39841103 GCTCCAGGGGGAGGGGTTCCAGG + Intronic
1007167870 6:39841261-39841283 GCTCCGGGGGGAGGGGTTCCAGG + Intronic
1007397367 6:41585469-41585491 GCTGCTGGGTGAGGAGCTGCAGG - Exonic
1007594067 6:43040643-43040665 TCTGCTGGGGGAGGCGGTTGGGG + Exonic
1008476523 6:51940426-51940448 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1008513364 6:52297592-52297614 GCCCCTGGAGGAGGAAGTGCTGG - Intergenic
1008771522 6:54984400-54984422 GCTCAGGGGAGAGGAGGTTAAGG + Intergenic
1008850216 6:56014282-56014304 GCTCCTTGGGGAGGAGGTTCTGG + Intergenic
1008951870 6:57170697-57170719 GTTCCAGGTGGAGGAGGTTAAGG + Intergenic
1009269819 6:61602345-61602367 GATCCTGGGGTAGGCGGTCCTGG - Intergenic
1009343605 6:62588194-62588216 GCCCCTGGGGAAGGTGGTTCTGG - Intergenic
1009379143 6:63007557-63007579 GCTCCTGGGGGAGGAAGATCTGG - Intergenic
1010011448 6:71052023-71052045 GCGCCTGAGGGAGCACGTTCTGG - Intergenic
1010071727 6:71752015-71752037 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1010586699 6:77664023-77664045 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1010829694 6:80513773-80513795 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1010841317 6:80651265-80651287 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
1010894548 6:81348605-81348627 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1011770947 6:90673680-90673702 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1012014393 6:93833546-93833568 GCTCCTGCGGGAGGAGGTTCTGG + Intergenic
1012066546 6:94557412-94557434 GCTCCTGCGGGAGGAGGTTCTGG + Intergenic
1012315823 6:97781841-97781863 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1012675096 6:102104199-102104221 GCTCCTGGGGGAGGCAGGCCTGG - Intergenic
1012689572 6:102295168-102295190 GCTGCTGTGGGAGGAGGTTCTGG - Intergenic
1013407891 6:109859223-109859245 GCTCCTGGGGGAGGAGGTTTTGG + Intergenic
1013808088 6:114015780-114015802 GAACCTGGGGGAGGCGGTCCTGG + Intergenic
1013843684 6:114425791-114425813 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1013891700 6:115034123-115034145 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1014115344 6:117663153-117663175 GATCCTGGAGGGGGATGTTCTGG + Intergenic
1014360163 6:120465734-120465756 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1014396066 6:120927432-120927454 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1014555845 6:122842071-122842093 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1014612081 6:123558884-123558906 GGTCCTGGGGGAGGAGGTTCTGG - Intronic
1014614676 6:123585756-123585778 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1014718893 6:124894279-124894301 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1014793994 6:125705329-125705351 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1014891541 6:126850996-126851018 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1015000519 6:128209072-128209094 GTTCCTGGGGGGGGTGGTTATGG - Intronic
1015165219 6:130194586-130194608 GCTCCTGGGAGAGGAGGTTCTGG - Intronic
1015266732 6:131297698-131297720 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1015269654 6:131325645-131325667 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1015278150 6:131405055-131405077 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1015288044 6:131507750-131507772 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1015323827 6:131903928-131903950 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1015801379 6:137064793-137064815 GCTCCTGGGGGAGGAGATTCTGG + Intergenic
1016114144 6:140260878-140260900 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1016204534 6:141455072-141455094 GCTCCTGGGGAAGGTGGTTCTGG - Intergenic
1016248859 6:142018050-142018072 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1016518803 6:144925414-144925436 GCCCCTGGGGGAGGAGGTTCTGG - Intergenic
1016650293 6:146453883-146453905 GCTCCTGGGGGATGAGGTGCTGG + Intergenic
1016853266 6:148642042-148642064 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1017269812 6:152492456-152492478 GATCCTGGGGGAGAAGGTCCTGG - Intronic
1017389495 6:153923727-153923749 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1017684794 6:156901459-156901481 GCGCCTGGGGTGGGAGGTGCGGG - Exonic
1017756295 6:157532076-157532098 GCCGCTGGGGGAGGAGGAGCAGG + Intronic
1017779335 6:157704115-157704137 CCTCCTGGGGGAGGAGGTTCTGG + Intronic
1018077594 6:160230737-160230759 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1018084499 6:160290039-160290061 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1018472656 6:164110381-164110403 GCTCCTGGGAGAGGACGAACTGG - Intergenic
1018495404 6:164342201-164342223 GCTCCTGGTGGAGGAGGTTCTGG + Intergenic
1018521471 6:164655619-164655641 GCTCCTGGAGGAGGAGGTTCTGG + Intergenic
1018582113 6:165316515-165316537 GCTCCCGGGGGATGATGTCCAGG + Intergenic
1018838100 6:167500153-167500175 GCCCCTGCTGGAGGATGTTCTGG + Intergenic
1019310947 7:360334-360356 GCTTCTGAGAGAGGAGGGTCGGG - Intergenic
1019337057 7:490480-490502 GTTCCTGGGGGAGGGGATTTGGG + Intergenic
1019561894 7:1663602-1663624 TCTGCTGGGGGAGGGGGATCAGG + Intergenic
1020014012 7:4820681-4820703 GCTCCTGGGGGAGGCAGAGCCGG - Intronic
1020316048 7:6906032-6906054 GCTCTTGGGGGAGGATGTTGCGG - Intergenic
1020323946 7:6960135-6960157 GCTCCTGGGAGAGGCGGTTCTGG + Intergenic
1020532717 7:9356887-9356909 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1020541145 7:9462023-9462045 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1020794212 7:12661809-12661831 GCTCCTGGGGAAGGAGGTCCTGG - Intergenic
1021198446 7:17698565-17698587 GCTCCTAGGGATGGAGCTTCTGG - Intergenic
1021429845 7:20547691-20547713 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
1021637314 7:22705486-22705508 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1021810661 7:24398519-24398541 GCTCCTGGGGGAAGAGGTTCTGG - Intergenic
1021868215 7:24979677-24979699 GCTCCCGGGGAAGGAGGACCCGG - Intronic
1021977898 7:26027655-26027677 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1022372870 7:29787089-29787111 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1022572795 7:31470495-31470517 GCTCCTGGGGGAGGTGGTTCTGG + Intergenic
1022710049 7:32841371-32841393 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1022854712 7:34303360-34303382 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1023435139 7:40134503-40134525 GGTCCGGGTGGAGGAGGTTGGGG - Exonic
1023698889 7:42874075-42874097 GTTCCTGGGGGAGGAGGTTCTGG + Intergenic
1024080096 7:45848870-45848892 GATCCGGGGGTAGGGGGTTCGGG - Intergenic
1024794108 7:53002631-53002653 GATCCTGGAGGAGGAGGAGCAGG + Intergenic
1026014852 7:66664917-66664939 ACTCTTGGGGGAGCAGCTTCAGG + Intronic
1026739909 7:72972702-72972724 GAGGCTGGAGGAGGAGGTTCAGG - Intergenic
1027103824 7:75392368-75392390 GAGGCTGGAGGAGGAGGTTCAGG + Intergenic
1027157884 7:75781395-75781417 GATCCTGGGGTAGGAGGTTCTGG - Intronic
1027158313 7:75784171-75784193 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1027228620 7:76260098-76260120 GGTCCTGGGGGAGAAGGGGCGGG - Exonic
1027851942 7:83461907-83461929 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1028348185 7:89809611-89809633 GCTCCTGCTGCAGGATGTTCTGG - Intergenic
1028589913 7:92483256-92483278 GATCCTGGGGGAGGTGGTCCTGG + Intergenic
1028670507 7:93396173-93396195 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1028690175 7:93642103-93642125 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1028841584 7:95434885-95434907 GCTCCTGGGCGAGAGGCTTCTGG - Exonic
1029124784 7:98288330-98288352 GCACCTGGGGGAGAAGGTCCTGG + Intronic
1029356679 7:100057285-100057307 GCTCCTGGGGCAGGATGGTCAGG - Exonic
1029500211 7:100924412-100924434 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1030163611 7:106531869-106531891 GCTCCTGGGGCAGAAGGTTCTGG + Intergenic
1030265918 7:107621766-107621788 GCTCCTGCTGGAAGAGGCTCTGG - Exonic
1030751501 7:113237046-113237068 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1031004665 7:116457726-116457748 GCTCCTGGGGGAGGAGGTTCTGG - Intronic
1031355196 7:120780612-120780634 GCTCCTGGGAGAGGAGGTTCTGG + Intergenic
1031364750 7:120889080-120889102 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1031399982 7:121317814-121317836 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1031422458 7:121567447-121567469 GCTCCTGGGGGAGGTGGTTCTGG + Intergenic
1031525589 7:122819163-122819185 GCTCCTGTGGGAGGAGGTTCTGG - Intronic
1031685843 7:124731281-124731303 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1031727935 7:125262370-125262392 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1031776321 7:125912231-125912253 GTTCCTGTGGGAGGAGGTTCTGG - Intergenic
1031777341 7:125919856-125919878 GCTCTTGGGGGAGGAGGTTCTGG - Intergenic
1032463360 7:132127729-132127751 TCTCCTGGGGGAGGGGTTTGGGG - Exonic
1033088554 7:138364793-138364815 GATCCTGGGGGAGGCGGTCCTGG - Intergenic
1033465037 7:141582253-141582275 GTTCCTGGGGGAGGTGGTCCTGG + Intronic
1033625584 7:143107064-143107086 GATCCTGGGGGAGGTGGTCCTGG - Intergenic
1033675954 7:143540690-143540712 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1033695881 7:143788749-143788771 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1033909471 7:146246847-146246869 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1034008672 7:147504246-147504268 GCTGCTGTGGGAGTAAGTTCAGG + Intronic
1034084835 7:148313518-148313540 GCTCCCGGGGGAGAAGGTTCTGG + Intronic
1034227728 7:149496749-149496771 GCTCCGGGGGAAGGAGTGTCAGG - Intronic
1034242902 7:149623791-149623813 GCTCCGGGGGAAGGAGTGTCAGG - Intergenic
1034962786 7:155372913-155372935 CCTCCTGGGGGAGGCGGATGTGG - Intergenic
1035053870 7:156020743-156020765 CCTCCTGGTGGAGGGGGTTTGGG - Intergenic
1035280233 7:157773740-157773762 GGACCTGGGGGCTGAGGTTCGGG - Intronic
1035326955 7:158071564-158071586 GCTCCTGGTGGAGGTGCTCCTGG + Intronic
1035326959 7:158071579-158071601 GCTCCTGGTGGAGGTGCTCCTGG + Intronic
1035326980 7:158071678-158071700 GCTCCTGGTGGAGGTGCTTGTGG + Intronic
1035327026 7:158071892-158071914 GCTCCTGGTGGAGGTGCTTGTGG + Intronic
1035412603 7:158657396-158657418 GCACCTGGTGTGGGAGGTTCTGG - Intronic
1035880666 8:3241684-3241706 GCTCCTGGGGGAGGTGTTTCTGG + Intronic
1036070926 8:5440109-5440131 GCTCCTGGGGGAGGCAGGCCTGG + Intergenic
1036281479 8:7404680-7404702 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1036339990 8:7906892-7906914 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1036372129 8:8170849-8170871 GCTCCTGGGGTAGGTGGTTCTGG - Intergenic
1036472333 8:9062903-9062925 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1036639491 8:10573511-10573533 GCTCCTGGGGAAGGTGGTTCTGG - Intergenic
1036878772 8:12494792-12494814 GCTCCTGGGGTAGGTGGTTCTGG + Intergenic
1037270648 8:17126107-17126129 GATCCAGGGGGATGAGTTTCAGG + Intergenic
1037814380 8:22104002-22104024 GCTCCTGGGCAAGGAGGAGCAGG + Exonic
1037819287 8:22128001-22128023 AATCCTGGGGGAGGAGGTGGGGG - Intronic
1037881315 8:22574807-22574829 GGTCCTGGGGAAGGAGGATGTGG - Exonic
1038224602 8:25644286-25644308 GCACCTGGGGGAGAAAATTCAGG - Intergenic
1038288154 8:26224916-26224938 GCTCCTGGGGCTGGATGTTGTGG + Intergenic
1038823741 8:30978090-30978112 GCTCCTTGAGGAAAAGGTTCTGG + Intergenic
1039038604 8:33385519-33385541 GCTCCTAAGGGAAGAGGGTCTGG + Intronic
1040611068 8:48982758-48982780 GCTCTTGGGGCAGGAAGTTAGGG + Intergenic
1041917536 8:63151765-63151787 GATCCTGGGGGAGGAAGTTCTGG + Intergenic
1042453554 8:68975414-68975436 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1042707366 8:71677154-71677176 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1042743168 8:72074749-72074771 TCTCCAGGGGTAGGAGCTTCAGG - Intronic
1043221678 8:77673585-77673607 GCTCCTAGGGGATGAGGCCCTGG - Intergenic
1043353674 8:79389573-79389595 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1043515235 8:80989844-80989866 GCTGCTGTGGGTGGAGGTCCAGG + Intronic
1043717900 8:83508609-83508631 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1043720903 8:83546212-83546234 GATCCTGGGGGAGGAGGCCCTGG - Intergenic
1043837734 8:85065215-85065237 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1044148519 8:88745683-88745705 GCTCTTGGGGGAGGAGTTTCTGG + Intergenic
1044258618 8:90093672-90093694 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1044417081 8:91950210-91950232 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1044921988 8:97177317-97177339 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1044925155 8:97203161-97203183 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1045197519 8:99946112-99946134 GCTCCTGGGGGAGAAGGTTCTGG - Intergenic
1045506378 8:102781628-102781650 GCTACTGGGGATGGAGGTCCTGG + Intergenic
1045644778 8:104288176-104288198 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1045658955 8:104416382-104416404 GCTGCTGGCTGAGGTGGTTCAGG - Intronic
1046074905 8:109303053-109303075 GATCCTTGGGGAGGCGGTCCTGG - Intronic
1046294116 8:112198065-112198087 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1046386345 8:113512981-113513003 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1046440009 8:114243579-114243601 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1046443244 8:114284234-114284256 GTTCCTGTGGGAGGAGGTTCTGG - Intergenic
1046512081 8:115214468-115214490 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1046961873 8:120121600-120121622 GATCATGGGAGAGGAGGTCCGGG + Intronic
1047699343 8:127433970-127433992 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG + Intergenic
1047829547 8:128615376-128615398 GCTTCTAGGGGAGGAGGTTCTGG + Intergenic
1047856369 8:128916661-128916683 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
1048097608 8:131312448-131312470 AGCTCTGGGGGAGGAGGTTCTGG - Intergenic
1048135470 8:131742963-131742985 GCTCCTGGGGAAGGTGCTTCTGG - Intergenic
1048143769 8:131821427-131821449 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1048168436 8:132083705-132083727 GCTCCTGTGGGAGGAGGTTCTGG + Intronic
1048207611 8:132427764-132427786 GCTCCTTGGAGAAGAGGTTGTGG - Intronic
1048585423 8:135770609-135770631 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1048728423 8:137411743-137411765 GCTCCTGGGGGAGGCGGTTCTGG + Intergenic
1048764238 8:137828284-137828306 GCTCCTGGGGGAAGTGGTTCTGG + Intergenic
1048996019 8:139794159-139794181 GCTCCTGGGGCAGGTGGCACGGG - Intronic
1049148304 8:141018193-141018215 GCCCCTGGTGGAGGTGGTTCTGG - Intergenic
1049261875 8:141643562-141643584 GTTCCTTGGTGAGGAGGTGCAGG + Intergenic
1049423063 8:142525314-142525336 GCACCTGGGGATGGAGGTTGTGG + Intronic
1049852937 8:144843861-144843883 GCTCATGTTGGAGGAGGTCCAGG + Intronic
1049868822 8:144957727-144957749 GCTCCTGGGGGAGGAGGTCCTGG + Intergenic
1050117598 9:2277809-2277831 GCTCCTGGGGGCGGCGGGCCTGG - Intergenic
1050140478 9:2511676-2511698 GATCCTGTGGGAGGAGGTCCTGG - Intergenic
1050258109 9:3814619-3814641 GCTTCTGGGGGAGGCAGTTCTGG + Intergenic
1050896070 9:10887009-10887031 GCTCCTGGGGGAGGTGGGCCTGG - Intergenic
1051052623 9:12950564-12950586 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1051606801 9:18924437-18924459 GGTTCTTGGGGATGAGGTTCTGG - Intergenic
1051849288 9:21489169-21489191 ACTCCTGGGGGAGGAGGTTCTGG + Intergenic
1051953410 9:22662035-22662057 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1052163079 9:25289915-25289937 GCTCCTGGGGGAGGTGGGCCCGG - Intergenic
1052191833 9:25671169-25671191 GCTCTTGAGGGTGGAGGTTCTGG - Intergenic
1052653331 9:31328657-31328679 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1052720644 9:32167979-32168001 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1053058028 9:35005731-35005753 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
1054711812 9:68518010-68518032 GGTCCAGGTGGAGGAGGATCTGG + Intronic
1054807490 9:69408220-69408242 GCTCCTGGGGGAGGCAGTTCTGG + Intergenic
1054945874 9:70795617-70795639 GCCCCTGGGGGAAGACGTTCGGG - Intronic
1055233059 9:74087906-74087928 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1055347722 9:75355248-75355270 GCTCCTGGGGGTGGTGGGCCTGG + Intergenic
1055626719 9:78183050-78183072 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
1055810043 9:80139654-80139676 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1055881744 9:81011250-81011272 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
1056044740 9:82704179-82704201 GCTCCTAGGGGAGGAGGTTCTGG + Intergenic
1056061156 9:82886000-82886022 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1056323882 9:85460889-85460911 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1056363706 9:85882928-85882950 GATCCTGGGGTAGGTGGTCCTGG - Intergenic
1056522444 9:87413169-87413191 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1056568573 9:87796560-87796582 ACTCATGGGGGAGGAGGATGGGG - Intergenic
1056679139 9:88701901-88701923 GTTCCTGGGGGAGGTGGCTGAGG + Intergenic
1056882977 9:90414818-90414840 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1057135069 9:92681783-92681805 GGTCATGGGGGAGGAGCCTCAGG - Intergenic
1057234843 9:93349848-93349870 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1057377990 9:94542070-94542092 GCTCCTTGGGGAGGAGGTTCTGG - Intergenic
1057683999 9:97217086-97217108 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1057867999 9:98696554-98696576 GCACGTGGGGGAGGAGGCCCAGG - Intronic
1057982080 9:99672402-99672424 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1058026210 9:100144161-100144183 GCTTCTTGGGGAGGAGGTTCTGG + Intronic
1058612399 9:106790440-106790462 GCTCCTGGGGGAGGTGGTTCTGG - Intergenic
1058622551 9:106898662-106898684 GGTGCTGGGGGAGGAGGTCAGGG + Intronic
1059340958 9:113597288-113597310 GCTGATGGGGCAGGAGGTCCAGG + Exonic
1059352706 9:113676936-113676958 GCTCCTGGGGGGGCAGGTGGAGG + Intergenic
1059546161 9:115178087-115178109 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1059574619 9:115475602-115475624 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
1059606710 9:115842672-115842694 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1059773286 9:117448234-117448256 GCTCCTGGAGGCTGAGGTTCTGG - Intergenic
1059863489 9:118489141-118489163 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1060095761 9:120788069-120788091 GCTCCAGGGGAAGGAGTTTGAGG + Exonic
1060318472 9:122534101-122534123 GCTCCTGGGGGAGGCGGGCCTGG + Intergenic
1060549947 9:124480192-124480214 GCTCCTGGGAGAGATGGGTCTGG - Intergenic
1060552614 9:124492745-124492767 GCTCATGGAGGAGGAGGTGATGG - Intronic
1060556929 9:124512833-124512855 GCCCTTGGGGCAGCAGGTTCTGG - Intergenic
1060737885 9:126078095-126078117 GCGCCTGGGGGAGGCAGTTCTGG + Intergenic
1061005902 9:127928278-127928300 GGTCCTGGGACAGGAGGGTCAGG + Intronic
1061085734 9:128397139-128397161 GATCCTGGGGGAGGAGGAGTGGG + Intergenic
1061498145 9:130987266-130987288 GCCACTTGGGGAGGAGGTTTGGG + Intergenic
1061583065 9:131549329-131549351 GCTCCTGGGGGAAGAGGTTCTGG - Intergenic
1061709852 9:132480158-132480180 GCTCCTGGGGAGGGCGGTCCAGG - Intronic
1061714476 9:132510147-132510169 GCTCCTGATGGATGGGGTTCGGG - Intronic
1061927506 9:133813132-133813154 GCACCTGGGGGTGGAGGGGCAGG + Intronic
1062107467 9:134763798-134763820 GCTCCTGCTGGAGCAGGATCTGG + Intronic
1062317925 9:135977643-135977665 GCTGCTGGGGGTGGAGGTCTGGG - Intergenic
1062317941 9:135977679-135977701 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062317956 9:135977715-135977737 GCTGCTGGGGGTGGAGGTCTTGG - Intergenic
1062317969 9:135977751-135977773 GCTGCTGGGGGCGGAGGTCTAGG - Intergenic
1062317984 9:135977787-135977809 GCTGCTGGGGGTGGAGGTCTTGG - Intergenic
1062317999 9:135977823-135977845 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318013 9:135977859-135977881 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318027 9:135977895-135977917 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318040 9:135977931-135977953 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318053 9:135977967-135977989 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062524001 9:136970945-136970967 GTCCCTGTGGGAGGAGGTTGTGG - Exonic
1062727067 9:138080528-138080550 GCTGATGGGTGAGAAGGTTCAGG + Intronic
1185736749 X:2501215-2501237 GGTCCTGGGGGGGGGGGTCCTGG - Intronic
1185858432 X:3556591-3556613 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1185960690 X:4543951-4543973 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1185989168 X:4873598-4873620 GCTTCTGGGGCAGGAGGCTGGGG - Intergenic
1185991058 X:4893835-4893857 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1186112867 X:6275645-6275667 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1186784065 X:12942066-12942088 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
1187086525 X:16048154-16048176 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1187099960 X:16182624-16182646 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1187103769 X:16220288-16220310 GCTCCTGGGGGAGGCGATCCTGG + Intergenic
1188333022 X:28896057-28896079 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1188463376 X:30452561-30452583 GCTCCTTTGGGAGGAGGTTCTGG + Intergenic
1188552650 X:31379748-31379770 GCTCCTGGGGGAGGCCATTCTGG - Intronic
1189407102 X:40735309-40735331 GCTCCCGGGGGAGGAGGGGCTGG + Exonic
1190363264 X:49668498-49668520 GAGCCTGGGGGAGAAGGTTTTGG + Intergenic
1191014198 X:55791773-55791795 GATCCTGGGGGAGGCGGTCCTGG + Intergenic
1192251415 X:69416994-69417016 GCGGCAGGGGGAGGAGGCTCAGG - Intergenic
1192454595 X:71266426-71266448 GATTCTGGGGGAGGAAGTCCTGG - Intergenic
1192706141 X:73529909-73529931 GCTCCTGGGGGAGGATGTCCTGG - Intergenic
1192872562 X:75198810-75198832 GCTGCTGGGGGATGGGGTTGGGG - Intergenic
1192914133 X:75635732-75635754 GATCCTGTGGGAGGAGGTCCTGG + Intergenic
1193885927 X:86984049-86984071 GCTCCTGGGGGAGGAGATTCTGG - Intergenic
1193941496 X:87684133-87684155 GCTCCTGAGGGAGGAGGTTCTGG - Intergenic
1194186251 X:90776784-90776806 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1194293627 X:92103702-92103724 GTTCCTGGGGGAGAAGGTTCTGG + Intronic
1194308543 X:92276525-92276547 GCTCCTGGGGGAGGAGGTTCTGG + Intronic
1194351287 X:92826735-92826757 GCTCCTAGGGGAGGAGGTTCTGG - Intergenic
1194367104 X:93025177-93025199 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
1194502984 X:94702285-94702307 GCTCCTGGGGGAGGCGGTACTGG + Intergenic
1194660686 X:96626270-96626292 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1194822770 X:98527737-98527759 GCTCCTGTGGGAGGAGGTTCTGG + Intergenic
1194873802 X:99162903-99162925 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1195162269 X:102182340-102182362 GATCCCAGAGGAGGAGGTTCAGG - Intergenic
1195166305 X:102223940-102223962 GATCCCAGAGGAGGAGGTTCAGG - Exonic
1195192555 X:102463148-102463170 GATCCCAGAGGAGGAGGTTCAGG + Exonic
1195291158 X:103432995-103433017 GTTCCTGGGGGAGGTGGTCCTGG + Intergenic
1195326860 X:103765241-103765263 GTTCCTGGTGGAGGTGGTCCTGG + Intergenic
1195841483 X:109180665-109180687 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1195908679 X:109868681-109868703 GCTCCTGGGGAAGGAGGTTCTGG + Intergenic
1196073080 X:111546161-111546183 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1196165542 X:112532860-112532882 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1196220988 X:113112184-113112206 GCTCCTGGGGGAGGAGGTTCAGG + Intergenic
1196227220 X:113180266-113180288 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1196300009 X:114042227-114042249 GCTCCTGGGGGAGGCGGTTCTGG - Intergenic
1196330822 X:114469007-114469029 GCTCCTGTGGGAGGAGGTTCTGG - Intergenic
1196341718 X:114604768-114604790 GCTCCTGTGGGAGGAGGTTCTGG + Intronic
1196496861 X:116333067-116333089 GCTCCTGGGGGAGGCGGGCCTGG - Intergenic
1196533542 X:116815930-116815952 GTTCCTGGGGGAGGAGTTTCTGG + Intergenic
1196572497 X:117281403-117281425 GCTCCTGGGGAAGGAGGTTCTGG - Intergenic
1196585122 X:117419907-117419929 GCTCCTGGACGAGGAGGTTCTGG - Intergenic
1196773855 X:119321231-119321253 GCTCCTGGGGGAGGAGTTTCTGG + Intergenic
1196992688 X:121346455-121346477 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1197064914 X:122224279-122224301 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
1197352063 X:125392311-125392333 GCTCCTGGGGGAGGGGGTTCTGG + Intergenic
1197571581 X:128156781-128156803 GCCCCTGGGAGAGGAGGTTCTGG - Intergenic
1197793636 X:130279279-130279301 GATCCTGATGGAGGAGGTCCTGG - Intergenic
1197933080 X:131714316-131714338 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1198598447 X:138261064-138261086 GTTCCTGGGAAAGGAGGTTCTGG - Intergenic
1198599402 X:138267775-138267797 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1198965921 X:142228794-142228816 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic
1198983758 X:142427031-142427053 GCTCCTGGAGGAGGCGGGCCTGG + Intergenic
1199576479 X:149317910-149317932 GTTCCTCGGGGAGGAGGTTCTGG - Intergenic
1200119744 X:153784656-153784678 GCTCCTCGGGTAGGCGGATCGGG + Intronic
1200532841 Y:4358863-4358885 GCTCCTGGGGGAGGAGGTTCTGG + Intergenic
1200611146 Y:5328248-5328270 GTTCCTGGGGGAGGAGGTTCTGG + Intronic
1200659612 Y:5943425-5943447 GCTCCTAGGGGAGGAGGTTCTGG - Intergenic
1200675318 Y:6141433-6141455 GCTCCTCAGGGAGGAGGTTCTGG - Intergenic
1201061663 Y:10051788-10051810 GATCCTGGGGGAGGGAGTCCTGG + Intergenic
1201473506 Y:14357862-14357884 GATCCTGGGGTAGGAGTTCCTGG + Intergenic
1201540637 Y:15101705-15101727 GATCCTGGGGGAGGAGACCCTGG + Intergenic
1201581388 Y:15514619-15514641 GCTCCTGGGGGAGGAGGTTCTGG - Intergenic