ID: 951888980

View in Genome Browser
Species Human (GRCh38)
Location 3:27551594-27551616
Sequence CCTGGGGGAGGAGGTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2042
Summary {0: 291, 1: 290, 2: 148, 3: 189, 4: 1124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888969_951888980 18 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888980 3:27551594-27551616 CCTGGGGGAGGAGGTTCTGGAGG 0: 291
1: 290
2: 148
3: 189
4: 1124
951888971_951888980 4 Left 951888971 3:27551567-27551589 CCAGATCTCTGGCACTTGTAGCA No data
Right 951888980 3:27551594-27551616 CCTGGGGGAGGAGGTTCTGGAGG 0: 291
1: 290
2: 148
3: 189
4: 1124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951888980 Original CRISPR CCTGGGGGAGGAGGTTCTGG AGG Intergenic
Too many off-targets to display for this crispr