ID: 951888981

View in Genome Browser
Species Human (GRCh38)
Location 3:27551603-27551625
Sequence GGAGGTTCTGGAGGAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 70, 1: 279, 2: 240, 3: 151, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951888969_951888981 27 Left 951888969 3:27551553-27551575 CCTTGGCACAGTGGCCAGATCTC No data
Right 951888981 3:27551603-27551625 GGAGGTTCTGGAGGAACCCCTGG 0: 70
1: 279
2: 240
3: 151
4: 317
951888971_951888981 13 Left 951888971 3:27551567-27551589 CCAGATCTCTGGCACTTGTAGCA No data
Right 951888981 3:27551603-27551625 GGAGGTTCTGGAGGAACCCCTGG 0: 70
1: 279
2: 240
3: 151
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951888981 Original CRISPR GGAGGTTCTGGAGGAACCCC TGG Intergenic
900475243 1:2873403-2873425 GGAGGGTCTGGTGGAGCCGCAGG - Intergenic
900541798 1:3206621-3206643 GGAGGACCTGTAGGAACCCGTGG + Intronic
900840784 1:5047080-5047102 GGAGGTTCTGGAGGAACACCTGG - Intergenic
900847471 1:5115355-5115377 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
900998619 1:6136235-6136257 GGCAGTCCAGGAGGAACCCCGGG + Intronic
901854364 1:12035090-12035112 GGAGGTGCTTGAGAAAGCCCTGG + Intergenic
902131655 1:14266789-14266811 GGAGGATGTGGAGAAAACCCAGG + Intergenic
902390798 1:16104292-16104314 GGAGGATCCCGAGGACCCCCCGG - Intergenic
903293490 1:22329262-22329284 GGCGGTGCTGGAGGGGCCCCGGG - Intergenic
903396029 1:23002425-23002447 GGAGGTCCTGGAGGAACGCCTGG + Intergenic
904393956 1:30205625-30205647 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
904711631 1:32434580-32434602 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
904996483 1:34635435-34635457 AGAGGTTCTGGAGGAACACCTGG + Intergenic
905060523 1:35135808-35135830 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
905165616 1:36081234-36081256 GAAGGATGTGTAGGAACCCCGGG + Intergenic
905168842 1:36098518-36098540 GCAGGGCCTGGAGGACCCCCAGG - Exonic
905178105 1:36150623-36150645 GGAGGGACTGGGGGAACCCTGGG - Intronic
905534717 1:38712253-38712275 AGAGGTTTTGAAGGAACCACAGG - Intergenic
905936262 1:41826663-41826685 GGAGGTTTTGAAGGAGCCCCTGG + Intronic
906080919 1:43087741-43087763 GGAGATTCTGGAGGAACCCTTGG - Intergenic
906938428 1:50234908-50234930 GGAGGTCCTGGACCCACCCCAGG - Intergenic
907292631 1:53426529-53426551 GGAGGTTCTAGAGGAACGCCTGG - Intergenic
907293600 1:53434479-53434501 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
907465680 1:54634768-54634790 GGAGGATCCAGAGGACCCCCTGG + Exonic
907503570 1:54901338-54901360 GGAGGTTCTGGAGGAACACCTGG + Intergenic
907516731 1:54997627-54997649 GGAGGTCCTGGAGGGAGCTCAGG - Intergenic
907521256 1:55024833-55024855 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
908461718 1:64353445-64353467 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
908591957 1:65645353-65645375 GGAGGTTTTGGAGGAAAGCCTGG + Intergenic
908852401 1:68388498-68388520 GGAGGTTCTGGAGGAAAGCCTGG - Intergenic
909035473 1:70590539-70590561 GAAGTTTCTGGAGGAACCCCTGG - Intergenic
909222663 1:72983310-72983332 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
909223655 1:72991261-72991283 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
909374160 1:74921149-74921171 AGAGGTCCTGGAGGAAGGCCTGG - Intergenic
909551022 1:76898251-76898273 GGAGGTTCTGGAGGAACCCCTGG + Intronic
909776695 1:79492040-79492062 GGATGTTCTGGAGGAAGGCCTGG + Intergenic
909788270 1:79642202-79642224 GGAGGTTCTGGAAGAACGCCTGG + Intergenic
909792980 1:79699821-79699843 GGAGGTTCTGGAGGAACTCCTGG + Intergenic
909909958 1:81247672-81247694 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
909978453 1:82070993-82071015 GGAGGTTCTGGAGGAACTCCTGG + Intergenic
910002747 1:82358336-82358358 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
910049378 1:82957549-82957571 GGAGGTTCTGGAGGAACACCTGG - Intergenic
910144133 1:84058700-84058722 GGAGTTTCTGGAGGAACGCCTGG + Intergenic
911147989 1:94570336-94570358 AGAGGGTTTGGAGGAACCCCTGG + Intergenic
911510617 1:98804718-98804740 GGAGGTTCTGGATGAACCCCTGG + Intergenic
911570400 1:99511870-99511892 GGAGCTTCTGGAGAAACACCTGG - Intergenic
911759786 1:101601512-101601534 GGTGGGCCTGGAGGAACCCCTGG + Intergenic
911966925 1:104382420-104382442 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
912296472 1:108475184-108475206 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
912449071 1:109758547-109758569 GGCTGTTCTGGAGGGATCCCCGG + Exonic
912675278 1:111674519-111674541 GGAGGTTCTGTAGAAACCAATGG - Intronic
912813562 1:112811672-112811694 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
912815310 1:112823945-112823967 GGAGGTTCTGGATGAACCCCTGG + Intergenic
913095778 1:115514044-115514066 GGAGGTTTTGAAGGAGCCCCTGG + Intergenic
913245131 1:116864365-116864387 GGCGGTCCTGGAGGAATGCCTGG - Intergenic
913273723 1:117118487-117118509 GGAGGCCCTGGAGGAAGCCCTGG - Exonic
914768148 1:150658125-150658147 GGAGGATCCCGAGGACCCCCCGG + Intronic
914981954 1:152422814-152422836 GGAGGTTCCCGAGGAACACCTGG - Intergenic
916071987 1:161175846-161175868 TGAGGAGCTGGAGGACCCCCTGG + Exonic
916486401 1:165263577-165263599 GGAAGTTGTGGAGGTAACCCAGG - Intronic
917763211 1:178187174-178187196 GGAGGTTATCAAGGAATCCCTGG - Intronic
917799286 1:178555583-178555605 GGAGGATCCTGAGGACCCCCCGG - Intergenic
918347113 1:183615880-183615902 GGAGGTTCTGGAGGAAGGCCTGG - Intergenic
918567674 1:185951777-185951799 GGAGGTTCTGGAGGAACGCCTGG + Intronic
918714408 1:187768974-187768996 GGAGGTTCAGGAGGAATGCCTGG + Intergenic
919476396 1:198037026-198037048 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
919730739 1:200912142-200912164 GGCTGCTCTGGAGGGACCCCGGG + Intronic
920428053 1:205894547-205894569 GGAGGATCCTGAGGACCCCCTGG + Intergenic
920657010 1:207884810-207884832 GCAGGTCCTGGAGGAGCCCCAGG - Intronic
920829398 1:209451168-209451190 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
921212417 1:212911738-212911760 GGAGGTTCTGGAGGAAGGCCTGG - Intergenic
921459782 1:215413421-215413443 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
921509255 1:216010239-216010261 GGAGGTTCTGGAGGAAGGCCTGG - Intronic
921520127 1:216147780-216147802 GGAGGTTCTGGAGGAATGCCTGG - Intronic
921732977 1:218597270-218597292 GGAGGTTCTGGAGGAAGGCCTGG + Intergenic
922048411 1:221968188-221968210 GGAGGTTTTGGAGGAACCCCTGG - Intergenic
922049535 1:221976584-221976606 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
922154071 1:223027884-223027906 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
922363548 1:224843934-224843956 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
922368500 1:224887678-224887700 GGAGGTTTTAAAGGAGCCCCTGG - Intergenic
922598972 1:226835500-226835522 GGAGGTCCTGGAGGAACGCCTGG - Intergenic
922906394 1:229176652-229176674 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
922934820 1:229414617-229414639 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
922973438 1:229762197-229762219 GGAGGCTCAGGAGGATCACCTGG + Intergenic
923075203 1:230603462-230603484 GGAGGTTCTGGAGGAACACCTGG - Intergenic
923244750 1:232120411-232120433 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
923257274 1:232232682-232232704 GGAGGTTCTGAAGGAACGCCTGG + Intergenic
923408625 1:233686913-233686935 GGAGGTTCTGGAGGAACACCTGG + Intergenic
923770740 1:236935732-236935754 GGAGGTTCTGGAGGAAGGCCTGG + Intergenic
923962783 1:239103603-239103625 GGAGGTTCTAGAGGAACCCCTGG - Intergenic
924813787 1:247425483-247425505 GCATGTTATGGAGAAACCCCAGG - Exonic
924896183 1:248339708-248339730 GGAGGTTCTGGAGGAATGCATGG + Intergenic
1063106411 10:2996459-2996481 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1063256389 10:4331892-4331914 GGACGTACAGGAGGAACTCCAGG + Intergenic
1063363164 10:5473344-5473366 GGCGGGCCTGGAGGAACACCTGG - Intergenic
1063509600 10:6633073-6633095 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1063527683 10:6800570-6800592 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1064298529 10:14101012-14101034 AGAGGTTCTTGGGGAAACCCTGG - Intronic
1064886995 10:20122638-20122660 GGAGGTTCTGGAGAAATGTCTGG + Intronic
1064991469 10:21260306-21260328 GAAGGCTCTGGAGAAAGCCCAGG + Intergenic
1065437628 10:25718679-25718701 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1065610585 10:27467690-27467712 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1066103399 10:32137134-32137156 GGCGGTCCTGGAGGAACAGCTGG + Intergenic
1066437215 10:35405958-35405980 GGAAGTTCTAGAGGAACCCCTGG + Intronic
1067267577 10:44759106-44759128 TGAGGTTTTGGAGGAACTCGAGG - Intergenic
1067360401 10:45573445-45573467 GGAGGTTCTGGAGGAACCCCTGG - Intronic
1067703207 10:48588552-48588574 AGAGTTTCTGGAGGGTCCCCAGG + Intronic
1068230972 10:54168988-54169010 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1068592346 10:58864496-58864518 GGAGGTTCTGGAGGAATGGCTGG + Intergenic
1070474925 10:76820802-76820824 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1070941826 10:80355275-80355297 GGGGGTTATGGACGGACCCCAGG - Intronic
1071550791 10:86564716-86564738 GATGGTCCTGGAGGAACGCCTGG + Intergenic
1071897734 10:90084519-90084541 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1071916200 10:90297238-90297260 GGAGGTTCTGGAGAAACGCCTGG - Intergenic
1071961111 10:90809658-90809680 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1072011279 10:91304966-91304988 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1072580258 10:96734445-96734467 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1073014017 10:100383978-100384000 GGCGGTCCTGGAGGAACACCTGG - Intergenic
1073206085 10:101770204-101770226 GGAGGTGCTGGGGGAGCCCTGGG - Intronic
1073709492 10:106021098-106021120 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1074380438 10:112975056-112975078 AGTGGTTTTGGTGGAACCCCCGG - Intronic
1074740777 10:116482886-116482908 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1075013487 10:118894187-118894209 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1075248696 10:120847081-120847103 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1075565682 10:123502156-123502178 TGAGGTCCTGGAAGAAACCCAGG - Intergenic
1076445057 10:130508786-130508808 CGAGGCTCTGCAGAAACCCCAGG + Intergenic
1076571445 10:131435916-131435938 CGAGGCTCTGGAGGAGCCCCTGG + Intergenic
1076916645 10:133425738-133425760 GGGGGTTCTTGGGCAACCCCTGG + Intergenic
1076936749 10:133570533-133570555 GGGGGTTCTTGGGCAACCCCTGG + Intergenic
1076995288 11:294694-294716 GGTGGGGCTGGAGGAACCCAGGG - Exonic
1077014862 11:394976-394998 GGAAGTCCTGGAGGAAAGCCAGG + Intronic
1077589879 11:3483113-3483135 GGCGGTTCTGGAGGAATGCCTGG + Intergenic
1077612182 11:3650168-3650190 GGAGGTTCTGGAGGAACCCCTGG - Intronic
1077679069 11:4222724-4222746 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1077688505 11:4319365-4319387 GGAGGTTCTGGAGGAACCCCCGG + Intergenic
1077766385 11:5163763-5163785 GGTGGTTCCGGAGGAACGCCTGG + Intronic
1077850798 11:6073316-6073338 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1078046126 11:7915640-7915662 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1078771968 11:14359260-14359282 TGAGGTTCGGGAGGTAACCCGGG + Intronic
1079230511 11:18645262-18645284 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1079447461 11:20570021-20570043 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1079727075 11:23890661-23890683 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1080027918 11:27632563-27632585 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1080227356 11:29975641-29975663 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1080532212 11:33188125-33188147 TGAGGTTGGGGAGGAACCCCAGG - Intergenic
1080994450 11:37582099-37582121 TGAGGTCCTGGAGGAACACCTGG + Intergenic
1081356804 11:42122808-42122830 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1081760834 11:45575484-45575506 TGGGGTTGTGGAGGAAGCCCTGG - Intergenic
1082304372 11:50553161-50553183 GGAGGATCCCGAGGACCCCCTGG + Intergenic
1083066369 11:59928209-59928231 GGAGGTTCCCGAGGACCTCCCGG + Intergenic
1083097544 11:60267024-60267046 GGAGGTGCTCGAGCAACACCAGG - Intergenic
1083534408 11:63455142-63455164 GGAGGTTCTGGAGGAAACCCTGG - Intergenic
1083560657 11:63671008-63671030 GGAGGAGCTGGAGGAGCCCCCGG + Intronic
1084047167 11:66575851-66575873 GGTGGTTCTGGAGGAACGCCTGG - Intergenic
1084232301 11:67761916-67761938 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1084245598 11:67854887-67854909 GGCGATTCTGGAGGAACGCCTGG + Intergenic
1084355551 11:68635944-68635966 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1084426686 11:69087875-69087897 GGATATTCTGGAGGAGCCCGGGG + Exonic
1084613276 11:70217756-70217778 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1084827089 11:71739691-71739713 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
1085803450 11:79612795-79612817 GGAGGTGCGGGAGGAGGCCCTGG - Intergenic
1085934268 11:81124056-81124078 TGAGGTTCTGGAGGAACGCCTGG - Intergenic
1085988013 11:81808447-81808469 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1087099097 11:94347952-94347974 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
1087099640 11:94351885-94351907 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
1087127817 11:94643850-94643872 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1087196915 11:95311755-95311777 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1087314674 11:96590157-96590179 GGAGGTTCTGGAGAAACACCTGG - Intergenic
1088321937 11:108563453-108563475 AGAGGTTGTGGGTGAACCCCTGG + Intronic
1088554959 11:111052425-111052447 GGAGGTTCTGGAGGAACCCTTGG - Intergenic
1089219451 11:116858603-116858625 GTAGCTGCTGGGGGAACCCCGGG + Intronic
1089349092 11:117811514-117811536 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1089471056 11:118720478-118720500 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1089580504 11:119478949-119478971 GGAGATTCAGGAGGATTCCCAGG - Intergenic
1089690688 11:120185101-120185123 TGAGATTCTGGAGGGAGCCCAGG + Intronic
1089867052 11:121641403-121641425 GGAGGTTCTGGAGGGACCCCTGG + Intergenic
1089987681 11:122829355-122829377 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1090107600 11:123869077-123869099 GGCAGTTCTGGAGGAATGCCTGG + Intergenic
1090526810 11:127546211-127546233 GGCGGTTCTGGAGGAATACCTGG + Intergenic
1090546490 11:127772555-127772577 GGCAGTTCTGGAGGAATGCCTGG + Intergenic
1090850598 11:130567842-130567864 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1090871957 11:130756986-130757008 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1090926938 11:131257965-131257987 GTAGGTTCTGGAGGAATGCCTGG + Intergenic
1091886513 12:4020763-4020785 GGAGGTTCTGGGGGAACACCTGG - Intergenic
1092416179 12:8292018-8292040 GGCGGTTCTGGAGGAATGCCTGG + Intergenic
1092474485 12:8807170-8807192 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1092626749 12:10336408-10336430 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1092723721 12:11465649-11465671 GGAGGTTCTGGAGGAATGCCTGG + Intronic
1092739326 12:11613174-11613196 GGAGGTTCTGGTGGAATGCCGGG + Intergenic
1092789707 12:12060625-12060647 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1092924856 12:13263450-13263472 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1093024329 12:14232812-14232834 GGAGGTCCTGGAGGAACGCCTGG - Intergenic
1093071166 12:14708353-14708375 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1093268012 12:17025183-17025205 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1093358434 12:18197183-18197205 GGTGGTTCTGGAGGAACACCTGG - Intronic
1093465052 12:19440164-19440186 GGAGGGCCTGGAGGAGCCCAAGG + Exonic
1093578814 12:20765609-20765631 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1093584520 12:20820481-20820503 GGAGGTTCTGGAGGAATGCCTGG + Intronic
1094316054 12:29138481-29138503 GGAGGTTCTGGAGGAACCCCCGG + Intergenic
1094400671 12:30058209-30058231 GGCGGGCCTGGAGGAACACCTGG - Intergenic
1094825753 12:34267870-34267892 GAAGGTTCTGGAGGAACCCCTGG - Intergenic
1095778138 12:46032094-46032116 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1095999028 12:48113611-48113633 GGCGGTCCTGGAGGAACACCTGG + Intronic
1096223146 12:49844971-49844993 TTTGCTTCTGGAGGAACCCCAGG - Intergenic
1096450396 12:51735741-51735763 GGAGGATCCCGAGGACCCCCCGG - Intronic
1096618322 12:52847205-52847227 GAAGGTTCTGGAAGGAGCCCTGG - Intronic
1096701082 12:53383240-53383262 GGAGGTTCTGGAGGGTTTCCTGG - Exonic
1097107260 12:56633156-56633178 GGAGGTGCTGCAGGAACACAGGG - Intronic
1097398585 12:59104072-59104094 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1097417056 12:59326698-59326720 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1097542201 12:60955463-60955485 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1098173640 12:67770127-67770149 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1098293013 12:68976558-68976580 GGTGGTTCTGGATGACACCCTGG - Intergenic
1098402246 12:70087633-70087655 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1098629057 12:72705582-72705604 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1098630034 12:72712373-72712395 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1098919903 12:76293692-76293714 GGAGGTCCTGGAGGAACACCTGG - Intergenic
1099188712 12:79542092-79542114 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1099292104 12:80786556-80786578 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1099492763 12:83307088-83307110 GGGGGTCCTGGAGCAAGCCCAGG - Intergenic
1099762584 12:86941032-86941054 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1099872788 12:88369910-88369932 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1099989906 12:89709888-89709910 GGCGGTTCGGGAGGGGCCCCAGG - Intergenic
1100561357 12:95751409-95751431 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1100940293 12:99717420-99717442 GGCGGGCCTGGAGGAACACCTGG - Intronic
1101092841 12:101305147-101305169 CCAGGTTCTGGAGAAAACCCTGG - Intronic
1101278401 12:103226159-103226181 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1102026808 12:109718369-109718391 GGAGGTTGGGGAGGGACCCCCGG - Intronic
1102422302 12:112813623-112813645 TGCGGTTCTGGAAGAACACCTGG + Intronic
1102604472 12:114058074-114058096 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1103055000 12:117811859-117811881 GGAGGTTCTGCAGGGACCTGAGG + Intronic
1104290758 12:127464486-127464508 GGAAGTTCTGAGGCAACCCCTGG + Intergenic
1104601849 12:130160490-130160512 GGAGGTGCTGGAGGAAGTCGGGG - Intergenic
1105497809 13:20946045-20946067 GCACGTGCTAGAGGAACCCCGGG + Intergenic
1106943442 13:34800876-34800898 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1107075576 13:36318675-36318697 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1107220297 13:37972655-37972677 GGTAGTTCTGGAGGAATGCCTGG + Intergenic
1107683144 13:42870897-42870919 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1108282067 13:48870602-48870624 GGCGGTCCTGGAGGAATCCCTGG + Intergenic
1108512993 13:51172100-51172122 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1108814124 13:54269089-54269111 GGAGGTTCTGGAGGAACGCGTGG - Intergenic
1108913422 13:55581724-55581746 GGAGGTTCTGGAGGAACGCGTGG + Intergenic
1108919548 13:55658453-55658475 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1108947434 13:56042544-56042566 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1108952949 13:56115897-56115919 GGAGGTTCTGCAGGAATGCCTGG + Intergenic
1109343579 13:61090589-61090611 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
1109352915 13:61207020-61207042 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
1109499291 13:63215356-63215378 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1109709669 13:66144816-66144838 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1109716745 13:66229860-66229882 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1110765473 13:79276368-79276390 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1110978489 13:81868407-81868429 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1111126046 13:83911760-83911782 AGAGGTTCTGGAGGAACGCCTGG + Intergenic
1111302045 13:86360639-86360661 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1111362110 13:87189906-87189928 GGAGGTTCTGGAGGAACCCCAGG + Intergenic
1111458842 13:88516304-88516326 GGAGATTCTGGAGGAACGCCTGG + Intergenic
1111630437 13:90841673-90841695 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1111631705 13:90852066-90852088 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1111749861 13:92315214-92315236 GGAAGTTCTGGAATAATCCCAGG + Intronic
1112236825 13:97644549-97644571 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1113324334 13:109267580-109267602 GGAGGTTCTGGAGGAATGTCTGG - Intergenic
1113962816 13:114134535-114134557 GGAGGTTAAGGCGGCACCCCTGG + Intergenic
1114221674 14:20702816-20702838 GGAGGTCCTGGAGGAACACCTGG - Intergenic
1115240604 14:31248822-31248844 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1115904805 14:38193024-38193046 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1116008490 14:39323265-39323287 AGAGGCTCTGTAGGGACCCCAGG - Intronic
1116534780 14:46015883-46015905 GGAGTTTCTGGAGGAACGCCTGG + Intergenic
1116573453 14:46546160-46546182 GGAGGTTCTGGAGGAACGCCAGG - Intergenic
1116613511 14:47106414-47106436 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1116702407 14:48258861-48258883 GGCGTTTCTGGAGGAATGCCTGG + Intergenic
1116703294 14:48265853-48265875 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1116952910 14:50895404-50895426 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1117174151 14:53130629-53130651 GGAGGTCCTGGAGGAATGCCTGG - Intronic
1117801181 14:59446289-59446311 GGTGGTTCTGGAGGAACACCTGG - Intronic
1117957915 14:61136901-61136923 GGTGGGCCTGGAGGAACGCCTGG + Intergenic
1118820833 14:69344759-69344781 GCAGGGTCTGGAACAACCCCTGG + Intronic
1118849680 14:69573997-69574019 GGAGGCGCTGGAGGATTCCCGGG + Intronic
1119022429 14:71126559-71126581 GGAGGTTCTGGGGGAACCCCTGG - Intergenic
1119248341 14:73131797-73131819 GGAGGTTTTGAAGGAGCCCCTGG + Intergenic
1119317199 14:73705724-73705746 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1119674848 14:76546120-76546142 GCAGGTGCTGGAGGAATCCTGGG - Intergenic
1120438054 14:84503684-84503706 GGAGGTTCAGGAGGAATGCCTGG + Intergenic
1120659958 14:87238516-87238538 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1121703648 14:95975181-95975203 GGCGGTTCTGGAGGAACACCTGG - Intergenic
1121980583 14:98450603-98450625 TGAAGTTCTGGAGGAGCCCCTGG + Intergenic
1122040994 14:98987432-98987454 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1122096273 14:99375125-99375147 AGAGCCTCTGGAGGAATCCCTGG + Intergenic
1122507634 14:102241861-102241883 GGCAGTTCTGGAGGAACGCCTGG - Intronic
1122653146 14:103237866-103237888 GGAGGATCCCGAGGACCCCCTGG + Intergenic
1123882496 15:24689058-24689080 GGAGGTTCTGGAGGAACGTCTGG + Intergenic
1124999075 15:34753049-34753071 GGAGGTCCTGGAGGAACTGGGGG - Exonic
1125045774 15:35241003-35241025 GGAGGTTCTGGAGGAACACCTGG - Intronic
1125131518 15:36289120-36289142 GGAGTTTCTGGAGGAACACCTGG + Intergenic
1125213220 15:37239674-37239696 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1125470073 15:39993803-39993825 GGAGGCTCTGCAGGAAGTCCTGG + Intronic
1125629218 15:41133741-41133763 GGAGGCCCTGGAGGAATGCCTGG - Intergenic
1126530156 15:49702615-49702637 GAAGGTTCTGGAGGAACGCCTGG + Intergenic
1126843745 15:52740820-52740842 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1126912408 15:53430311-53430333 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1128601788 15:69001172-69001194 GGAGGTTCTGCAGGGAGCTCTGG - Intronic
1128793849 15:70450833-70450855 GGAGGGCCTGGAGGATTCCCAGG - Intergenic
1129259434 15:74356162-74356184 GGTGGTCCTGGAGGAATGCCTGG - Intronic
1129997984 15:80023253-80023275 GCAGGTCCTGGAGGAGCTCCAGG - Intergenic
1130855112 15:87833500-87833522 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1130945947 15:88550980-88551002 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1131037755 15:89235293-89235315 GGAGGATCCCGAGGATCCCCTGG - Intergenic
1131684178 15:94753007-94753029 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1131684706 15:94756711-94756733 GGCAGTTCTGGAGGAAATCCTGG - Intergenic
1132263013 15:100442520-100442542 GGCAGTTCTGGAGGAATGCCTGG - Intronic
1132340410 15:101074770-101074792 GGAGGTTCTGGAGGAATGCCTGG - Intronic
1132497570 16:271026-271048 GGAGCTCCTGGAGGACCCCGTGG - Exonic
1132568434 16:633736-633758 GGAGGTGCTGGAGGAGCCCGAGG + Exonic
1133651392 16:7816937-7816959 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1133765739 16:8836492-8836514 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1133766766 16:8843559-8843581 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1133869546 16:9674592-9674614 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1133938173 16:10285388-10285410 GGAGGTCGTGGAGGAAACCCTGG - Intergenic
1134342181 16:13356047-13356069 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1134438383 16:14282352-14282374 GGAGGAGCTGGGGGAAGCCCAGG + Intergenic
1135025417 16:18995608-18995630 GGCGGTCCTGGAGGAACGCCTGG + Intronic
1135599484 16:23769783-23769805 GGAGGAGCTGGAGGTACCACAGG + Intergenic
1135693707 16:24567357-24567379 GCAGGAGCTGGAGGAAACCCTGG - Exonic
1136371631 16:29840381-29840403 GGAGGTGGTGGAGGAGCGCCAGG + Exonic
1136529948 16:30861390-30861412 GGAGGTCCTGGAGGAACGCCTGG - Intronic
1137361628 16:47821894-47821916 TGAGGTTATGGATGAACCCATGG + Intergenic
1138759104 16:59521107-59521129 GGTGGTTCTGGAGGAACTCCTGG + Intergenic
1138804947 16:60081066-60081088 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1139039239 16:62982622-62982644 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1139225918 16:65233311-65233333 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1139230603 16:65278728-65278750 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1139943053 16:70619943-70619965 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1139943723 16:70624260-70624282 GGAGGTTCTGGAGGAATACCTGG + Intronic
1140904090 16:79395667-79395689 GGAGACTCTGAAGGAACTCCAGG - Intergenic
1141229699 16:82153869-82153891 GAAGCTTCTGGAGGGATCCCAGG - Intronic
1141570182 16:84929453-84929475 GGGGGTTATGGGGGAACCCTCGG + Intergenic
1141865206 16:86745500-86745522 GGAGGTTCTGGAGGAACGTCTGG + Intergenic
1141961037 16:87409302-87409324 GGAGGTTCTTGGGGAGCCCGTGG + Exonic
1142471622 17:166277-166299 GGAGGCACTGGCGGAACCCCGGG - Intronic
1142530535 17:576715-576737 GGAGGTTCTGTGGGAACGCATGG - Intronic
1143400312 17:6638890-6638912 GCAGGTTCTGGGGGTGCCCCAGG - Intronic
1143414347 17:6735081-6735103 GGAGGTTCTAGAGGAACCCCTGG + Intergenic
1144104669 17:11974129-11974151 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1144462495 17:15469222-15469244 GGAGGTTCTTGTGGAACCACAGG - Intronic
1145241371 17:21242583-21242605 GTAGGTTCTGCAGGAAACCAAGG - Exonic
1146122459 17:30207759-30207781 GGTGGTTCTGGAGGATCTGCTGG - Exonic
1146597894 17:34185508-34185530 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1146684442 17:34831619-34831641 GGGGGTGCTGAAGAAACCCCAGG + Intergenic
1146691093 17:34876700-34876722 GCAGATGCTGGAGGAACCCATGG + Intergenic
1148457736 17:47820060-47820082 GGAGGTGGTGGAGGAGCCTCGGG - Exonic
1148639145 17:49172236-49172258 GGAGGATCCCGAGGATCCCCTGG - Intergenic
1148951983 17:51321328-51321350 GGAGCTTCAGGAAGAACCCAGGG - Intergenic
1149319565 17:55470033-55470055 GGAGGTCCTGGAGGAACGCCTGG - Intergenic
1151428894 17:74049419-74049441 GCAGGTTTTGGTGGAGCCCCTGG + Intergenic
1151839758 17:76609430-76609452 GGAGGTTCCGGAGGAATGCCTGG + Intergenic
1151892960 17:76962010-76962032 GGAGGGCCTGGAGGAGCCACAGG - Intergenic
1152290508 17:79437350-79437372 CAAGGTTCTGGAGGAGCTCCAGG - Intronic
1152453956 17:80402140-80402162 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1152758750 17:82097820-82097842 GAAGGGCCTGGAGGAGCCCCCGG - Intronic
1152774758 17:82194094-82194116 GGAGGCTCTGAAGGAAGCCGGGG - Exonic
1153377753 18:4400114-4400136 AGTGGTTCAGGAGGAAGCCCTGG - Intronic
1155173816 18:23286274-23286296 GGCGGTTCTGGAGGAATGCCTGG - Intronic
1155697019 18:28696576-28696598 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1155941546 18:31806039-31806061 GGAGATTCTGGAGGTACCCCTGG - Intergenic
1156237357 18:35218003-35218025 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1156251934 18:35359784-35359806 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1156302245 18:35846128-35846150 GGCGGTTCTGGAGGAACCCCTGG - Intergenic
1156924056 18:42555966-42555988 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1156938528 18:42738886-42738908 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1156958176 18:42993108-42993130 GGAGGTTCTGGAGGAACACCTGG - Intronic
1157906394 18:51573514-51573536 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1158001318 18:52622539-52622561 GAAGGTCCTGAATGAACCCCTGG - Intronic
1158336374 18:56417825-56417847 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1158394647 18:57070102-57070124 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1158576699 18:58644457-58644479 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
1159164464 18:64683875-64683897 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1159835049 18:73326871-73326893 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1159926164 18:74270807-74270829 GGAGGTCCTAGAGGACTCCCTGG + Intronic
1159929216 18:74294667-74294689 GGAGGTCTTGGAAGAACGCCTGG - Intergenic
1160572821 18:79830566-79830588 GGCGGTTCTGGAGGGACCCATGG - Intergenic
1161407759 19:4099871-4099893 GGAGGTTGAGGTGGAAGCCCAGG + Intronic
1161424992 19:4198414-4198436 AGAGGGTCTGGAGGGACCGCGGG - Intronic
1161435081 19:4258280-4258302 GGAGGTGCTGGAGAACCTCCAGG + Exonic
1161513663 19:4684940-4684962 GGAGGCTCTGGATGGACACCTGG + Intronic
1161581869 19:5085649-5085671 GGGGGTCCAGGAGGAAGCCCAGG - Intronic
1161590450 19:5127004-5127026 GGAGGCTCTGGTGGAAACCCCGG + Intronic
1161661715 19:5550705-5550727 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1161711213 19:5849324-5849346 GGAGGTTCTGGAGGAACCCCTGG - Intronic
1161712037 19:5854344-5854366 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
1162004340 19:7767698-7767720 GGAGGTTGGGGGGGACCCCCAGG - Intronic
1162262208 19:9542470-9542492 GGAGGTCCTGGAGGAACACCTGG - Intergenic
1162286670 19:9744060-9744082 GGAGGTTTTGAAGGAGCCCCTGG - Intergenic
1162490889 19:10990920-10990942 GGAGGTCCGAGAGGACCCCCTGG + Intronic
1163487287 19:17595663-17595685 GGAGGTTCTGGAGGAATCCCTGG - Intergenic
1163907181 19:20157767-20157789 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1164024608 19:21339845-21339867 GGAGGATCCTGAGGACCCCCCGG - Intergenic
1164080801 19:21860021-21860043 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
1164152969 19:22570475-22570497 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1164258760 19:23551499-23551521 GGAGGTCCTGGAGGAACACCTGG - Intronic
1164459232 19:28433338-28433360 GGTGGTGCTGGAGGAATGCCTGG + Intergenic
1164998257 19:32739464-32739486 GGAGATGCAGGAAGAACCCCAGG - Intronic
1165454754 19:35903992-35904014 GGAGGTGCTGGGGAAACCCTGGG + Intronic
1165497008 19:36158893-36158915 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1165510321 19:36262959-36262981 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1165835355 19:38751845-38751867 GGCGGTTCTGGAGGAACGCCTGG - Intronic
1166151984 19:40881478-40881500 GGAGGCTATGGCAGAACCCCCGG - Intronic
1166498944 19:43326978-43327000 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1166658938 19:44632517-44632539 GGAGGATCCTGAGGACCCCCCGG - Intronic
1166783308 19:45353316-45353338 GGATGTTCTCAAGGATCCCCTGG + Exonic
1166905796 19:46107525-46107547 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
1166919325 19:46218168-46218190 GGGAGTTCTGCAGGGACCCCAGG - Intergenic
1166927144 19:46276801-46276823 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1167046606 19:47053223-47053245 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1167259470 19:48450396-48450418 GCAGGTGGTGGAGGAGCCCCAGG + Exonic
1167902146 19:52630006-52630028 GGAGGTTCTGGAGGAATGCCTGG - Intronic
1168051638 19:53833843-53833865 GAAGGTTCTGGAGGAACGCCTGG - Intergenic
1168187970 19:54713297-54713319 GGAGGTTCTGGAAGAAAGTCTGG + Intergenic
1168212120 19:54898361-54898383 AGAGGTTCTGGAGGAACCCCTGG + Intergenic
1168227989 19:55010259-55010281 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1168534624 19:57158631-57158653 GAAGGTTCTAGAGGAGACCCAGG + Intronic
925003866 2:426823-426845 GGGGGTTCTGCAGGCACGCCGGG + Intergenic
925544551 2:5003214-5003236 GGACGTTCTGGAGGAACGCCTGG - Intergenic
925828822 2:7876137-7876159 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
926391637 2:12399952-12399974 GGTGGTGTTGGAGGAACCCATGG + Intergenic
926407769 2:12571991-12572013 TGAGGTTCTGGAGTAAAGCCTGG - Intergenic
926413587 2:12628736-12628758 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
926464095 2:13167466-13167488 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
926815550 2:16795417-16795439 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
926877286 2:17495487-17495509 GGAAGTTCCAGAGGGACCCCAGG - Intergenic
927717950 2:25364589-25364611 GGAGATCATGGAGGAAGCCCGGG + Intergenic
928086202 2:28347880-28347902 GCAGGTTCTGGAGGGACCCAAGG - Intergenic
928395338 2:30939420-30939442 GGAGGTTCTGTTGGTACCTCTGG + Intronic
928778301 2:34791942-34791964 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
928827658 2:35440573-35440595 GGCGTTTCTGGAGGAACGCCTGG + Intergenic
928857168 2:35815315-35815337 GGCGTTTCTGGAGGAACGCCTGG - Intergenic
928928560 2:36601270-36601292 GGAGGTTCTGGAGGAACCCCTGG - Intronic
929076677 2:38084241-38084263 GGAGGTTCTGGAGGAACGCCTGG + Intronic
929684532 2:44022519-44022541 GGCGGTCCTGGAGGAACACCTGG + Intergenic
929793068 2:45037911-45037933 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
930099083 2:47589143-47589165 GGAGGCCCTGGAGGAATGCCTGG + Intergenic
930260739 2:49143134-49143156 GAAGGTTCAGGAGGAAGCCTGGG + Intronic
930487366 2:52025589-52025611 GGCAGTTCTGGAGGAATGCCTGG + Intergenic
930955095 2:57195201-57195223 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
931026396 2:58116891-58116913 GGAGGTTCTGGAGGAACGCCTGG + Intronic
931042611 2:58315931-58315953 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
931264940 2:60652298-60652320 GAAGGTTCTGGAAGAGCCCATGG + Intergenic
931513738 2:63028391-63028413 GGAGGCTCTGGAGACACCCTGGG + Intronic
931608929 2:64078645-64078667 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
931625774 2:64254763-64254785 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
931850421 2:66246166-66246188 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
931948254 2:67333832-67333854 GGTGGTTCTGGAGGAACGCCTGG - Intergenic
932159463 2:69447127-69447149 GGAGGTCCTGGAGGAACACGTGG + Intergenic
932295850 2:70622862-70622884 GGAGGTTCTGGAGGAACAACTGG - Intronic
932358821 2:71088519-71088541 GAAGGTTCTGGAGGAACGCCTGG + Intergenic
932367651 2:71163159-71163181 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
932854214 2:75217268-75217290 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
932973957 2:76577329-76577351 AAAGGTTCTGGAGGAACGCCTGG + Intergenic
933013087 2:77090611-77090633 GGAGGTTCTGGAGGAAGGTCTGG - Intronic
933079268 2:77967344-77967366 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
933163728 2:79053622-79053644 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
933179771 2:79215294-79215316 GGCGGGCCTGGAGGAACGCCTGG + Intronic
933329524 2:80877942-80877964 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
933552396 2:83792385-83792407 GGAGCTTCTGGAGGAACGCCTGG + Intergenic
934141257 2:89050154-89050176 GGAGGTCCTGGAGGAATGCCGGG - Intergenic
934227983 2:90150390-90150412 GGAGGTCCTGGAGGAATGCCGGG + Intergenic
934767584 2:96888576-96888598 GGAGGTTGTGGAGAAAGGCCTGG - Intronic
935101583 2:100001025-100001047 GGGGGTTCTTGAGCAGCCCCAGG + Intronic
936066641 2:109337499-109337521 GGGAGTCCTGGAGGCACCCCCGG + Intronic
936521901 2:113216721-113216743 GGAGGTTCTGGAGCTGCCACTGG - Exonic
936794297 2:116187744-116187766 GGAGGTTCTGGAGGAATCCCTGG + Intergenic
936870789 2:117132554-117132576 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
936883331 2:117280976-117280998 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
937419239 2:121740770-121740792 GCAGGTCCTGGAGGACCTCCGGG + Intronic
937796636 2:126030342-126030364 GGAGGTTCTGGTGGAAAACTGGG - Intergenic
938210151 2:129460174-129460196 AGAAGCTCTGGAGAAACCCCAGG - Intergenic
939083142 2:137686419-137686441 GGAGGTTCCGGAGGAACACCTGG + Intergenic
940182936 2:150955274-150955296 GGAGGTCCTGGAGGAACCCTTGG - Intergenic
940216821 2:151311072-151311094 GGGGGTTCTGGAGGAACCCCTGG - Intergenic
940508794 2:154586712-154586734 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
940530185 2:154869556-154869578 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
940675806 2:156723544-156723566 GGTGGTTCTGGAGGAATGCCTGG + Intergenic
940726442 2:157341578-157341600 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
941340396 2:164298090-164298112 GGAGGTTCTGGAGGAACACCTGG - Intergenic
941353382 2:164461345-164461367 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
941456192 2:165713971-165713993 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
942730295 2:179055231-179055253 GGCGGTTCTGGAGGAACCCCTGG + Intergenic
943412935 2:187563954-187563976 GGAGGTTCTGGAGGAATGCCTGG + Intronic
943421588 2:187673953-187673975 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
943835399 2:192509715-192509737 GGAGGTTCTGGAGGAACCCTTGG - Intergenic
943865343 2:192920294-192920316 GAAGGTTCTGGAGGAACCCCTGG - Intergenic
943951292 2:194134354-194134376 GGCGGGCCTGGAGGAACGCCTGG + Intergenic
944057316 2:195536308-195536330 GGAAGATCTGAAAGAACCCCAGG + Intergenic
944387446 2:199181607-199181629 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
944394135 2:199249160-199249182 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
944870650 2:203908451-203908473 GGAGGGTCTGGAAGGATCCCTGG + Intergenic
944876134 2:203965392-203965414 GGAGCTTCTGGAGGAACGCCTGG + Intergenic
945153107 2:206810333-206810355 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
945173452 2:207019476-207019498 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
945301488 2:208219712-208219734 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
945361645 2:208901475-208901497 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
945394297 2:209301458-209301480 GGAGGTTCTGGAGGAACACTTGG - Intergenic
945858116 2:215091823-215091845 GGACGTCCTGGAGGAACACCTGG - Intronic
945938314 2:215924606-215924628 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
946157008 2:217813603-217813625 GGAGGTGCTGGAGGGACCCAGGG - Intronic
946215034 2:218177507-218177529 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
946231766 2:218295753-218295775 GGAGGCTCTGGTGGTGCCCCTGG + Intronic
946781048 2:223193316-223193338 GGCGGTTCTGGAGGAATGCCTGG + Intronic
946871761 2:224091326-224091348 AGAGATTTTGGGGGAACCCCTGG + Intergenic
946886496 2:224227525-224227547 GGAGGCTCTGGAGGAATACCTGG - Intergenic
946893270 2:224298910-224298932 GGAGGTTCTGGAGGAATACCTGG - Intergenic
947817646 2:233048786-233048808 GGAGAATCTGGAGGAGCCCCTGG + Intergenic
948390681 2:237609190-237609212 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
948652474 2:239457078-239457100 GGGAGTTCTGGAGGCAGCCCTGG - Intergenic
948725574 2:239931742-239931764 GGAGGCTCTTGGGGAGCCCCAGG - Intronic
948778940 2:240305116-240305138 GGGGGCTCAGGATGAACCCCCGG + Intergenic
949056563 2:241931195-241931217 GGAGGGTCTGGGGGAGGCCCAGG + Intergenic
1168739343 20:174753-174775 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
1169331935 20:4722999-4723021 GGAGGGCCTGGGGGAACACCAGG - Intronic
1170068868 20:12343751-12343773 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1170106231 20:12756107-12756129 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1170165738 20:13359196-13359218 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1170325491 20:15151309-15151331 GGAGGTTCTGGAGGAATGCCTGG + Intronic
1170680437 20:18521073-18521095 GGAGGTTCTGGAGGAACCCCTGG + Intronic
1170820703 20:19754621-19754643 GGAGGTTCTAGAAGAACGCCTGG + Intergenic
1172177701 20:32982611-32982633 TCAGGTGCTGGAGGAACCCTGGG + Intergenic
1172177735 20:32982745-32982767 CCAGGTGCTGGAGGAACCCCGGG + Intergenic
1173101908 20:40095583-40095605 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1173118868 20:40271293-40271315 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1173652032 20:44672594-44672616 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
1174176785 20:48650385-48650407 GGAAGGCCTGGAGGAACCCAAGG + Intronic
1175163419 20:57025385-57025407 TGAGGTCCTTGAGGAGCCCCGGG - Intergenic
1175344361 20:58261241-58261263 AGAGGTCCTGCAGGAACACCTGG + Intergenic
1175625450 20:60485175-60485197 GGAGGTGCTGGAAGTGCCCCTGG - Intergenic
1175678130 20:60964870-60964892 GGAGGCTCTTCAGGAACACCTGG + Intergenic
1175891656 20:62318453-62318475 GGAGCGCCTGGAGGAAGCCCTGG - Exonic
1175970619 20:62684993-62685015 TGAGGTGCTGCAGGAGCCCCTGG - Intronic
1175971868 20:62690396-62690418 GAAGGCTCTGCAGGAGCCCCGGG + Intergenic
1176113137 20:63419530-63419552 AGAGGTTCTGGAGGAGCCAGGGG - Intronic
1177031176 21:15983267-15983289 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1177100621 21:16894411-16894433 GGCAGTTCTGGAGGAATGCCTGG - Intergenic
1177102671 21:16916223-16916245 GGAGGTTCTGGAGCAATGCCTGG - Intergenic
1177119562 21:17123728-17123750 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1178001197 21:28163449-28163471 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1179015286 21:37590486-37590508 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1179387553 21:40957185-40957207 GGAGGTTCTGGAGGAATACCTGG - Intergenic
1179650369 21:42804502-42804524 GGAGTTTCTGGAGGAACCCCTGG + Intergenic
1181155498 22:20917603-20917625 GGAGTCACTGGAGGCACCCCTGG + Exonic
1181439897 22:22930351-22930373 GGGGGTCCTGGAGGCAGCCCAGG - Intergenic
1182113946 22:27744218-27744240 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1182478047 22:30587377-30587399 GGAGCTTCCGGACGAACACCTGG + Exonic
1182732271 22:32505012-32505034 GGAGGTTCCGGAGGAACGCCTGG - Intergenic
1182998603 22:34836548-34836570 GGAAGTTCTGGAGGAACGCCTGG - Intergenic
1183486448 22:38089650-38089672 CGCGGTTCTGGAGCATCCCCCGG + Exonic
1183604927 22:38862746-38862768 GGAGGTCCTGGAGGAGAGCCAGG - Exonic
1184550907 22:45203708-45203730 GGAGGGGCTGCAGGTACCCCTGG + Intronic
1184709990 22:46244192-46244214 GGGGGTGCTGCAGGAACCCCCGG + Exonic
949162098 3:894144-894166 GGAGGTTCTGGGGGAACGCCTGG + Intergenic
949190401 3:1243287-1243309 GGAGGTTCTGGGGGAACGCCTGG + Intronic
949671150 3:6399914-6399936 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
949704275 3:6797972-6797994 GGAGGTACTGAAGGAAAACCGGG + Intronic
949827437 3:8179251-8179273 GGAGGTTCTGGAGGAAGGCCTGG - Intergenic
950926492 3:16746552-16746574 GAAGGTTCTGGAGGAACGCCTGG - Intergenic
951298815 3:20970987-20971009 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
951332331 3:21382038-21382060 GGCGGTTCTGGAGGAATGCCTGG + Intergenic
951762799 3:26163845-26163867 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
951888981 3:27551603-27551625 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
952296873 3:32069835-32069857 GGATGTTTTGAAGGAGCCCCTGG - Intronic
952663461 3:35877800-35877822 GGAGGTTCTGGAGGAAACCCTGG + Intergenic
952896060 3:38079755-38079777 GGAGGTTCTGGAGGAATGCCTGG + Intronic
953077137 3:39581275-39581297 GGAGGTTCTGGAGAAACGCCTGG + Intergenic
953599443 3:44348498-44348520 GGAGGTCCTGAAGGAATGCCTGG + Intronic
953656569 3:44859159-44859181 GGCGGTCCTGGAGGAAAGCCTGG + Intronic
953825704 3:46249766-46249788 GGAGGTTCTGGAGGAACGCCTGG + Intronic
953841167 3:46391213-46391235 GGAGGTCCTGGAGAAATGCCTGG + Intergenic
954183459 3:48899158-48899180 CTAGGTGCTGGAGGCACCCCTGG + Intergenic
954698430 3:52439688-52439710 AGTGGTTCTGGAGGAGCTCCAGG - Exonic
954969271 3:54637958-54637980 GGAGGTTCTGGAGAAACGTCTGG + Intronic
955090226 3:55743259-55743281 GGAGAAACTGGAGGAACCGCCGG - Intronic
956548994 3:70438338-70438360 GGCAGTTCTGGGGGAACGCCTGG + Intergenic
956709213 3:72025223-72025245 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
957059903 3:75473507-75473529 GGTGGTTCTGTAGGAACACCTGG + Intergenic
957155119 3:76536127-76536149 GGAGGTCCTGAAGGAATGCCTGG + Intronic
957295231 3:78326037-78326059 GGAAGTTCTGGAGGAATGCCTGG - Intergenic
957317317 3:78586622-78586644 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
957610421 3:82458881-82458903 TGAGGTTCTAGAAAAACCCCTGG + Intergenic
958676816 3:97276460-97276482 GGAGGTTCTGGAGGAACACCTGG + Intronic
958724928 3:97893462-97893484 GGAAGCTCTCTAGGAACCCCTGG + Intronic
958755530 3:98246220-98246242 GGAGGTTTTGAAGGAACCCCTGG - Intergenic
959288355 3:104443394-104443416 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
959485779 3:106926205-106926227 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
959543699 3:107570117-107570139 GGCAGTCCTGGAGGAACCCCTGG + Intronic
959972272 3:112421040-112421062 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
960282882 3:115796981-115797003 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
960310119 3:116108794-116108816 GGAGGTTCTGGAGGAACGCCTGG + Intronic
961164767 3:124756028-124756050 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
961293505 3:125865938-125865960 GGCGGTTCTGGAGGAACACCTGG - Intergenic
961711629 3:128832667-128832689 GGCAGTTCTGGAGGAACACCTGG + Intergenic
961712719 3:128839655-128839677 GGATGTTTTGAAGGAGCCCCTGG + Intergenic
961730582 3:128961940-128961962 GGAGGTTCTGGAGGAACACCTGG - Intronic
961859682 3:129905707-129905729 GGAGGATCCCGAGGATCCCCTGG + Intergenic
961881044 3:130061507-130061529 AGATGTTCTGGAGGAACACCTGG - Intergenic
961893716 3:130150615-130150637 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
962205561 3:133431363-133431385 GGAGGTTCTGGAGGAACGCCTGG - Intronic
962660628 3:137597708-137597730 GGCGGTTCTGTAGGAATGCCTGG - Intergenic
963111845 3:141694762-141694784 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
963319744 3:143799517-143799539 GGAGGTTCTGGAAGAACCCCTGG - Intronic
963425212 3:145115214-145115236 GGAGGTTCTGGAGGAACCACTGG - Intergenic
963456666 3:145554651-145554673 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
963468609 3:145712632-145712654 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
963521620 3:146364287-146364309 GGTGGTTCTGGAGAAATGCCTGG - Intergenic
963663339 3:148153885-148153907 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
963684326 3:148416582-148416604 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
964067893 3:152599677-152599699 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
964125459 3:153230169-153230191 GGCGGGCCTGGAGGAACGCCTGG + Intergenic
964176046 3:153826751-153826773 GGATGTTTTGAAGGAGCCCCTGG + Intergenic
964906517 3:161725337-161725359 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
964940960 3:162157615-162157637 GGAGGTTCTGGATGAATCCCTGG + Intergenic
964983630 3:162714636-162714658 GGAGGTTCTGGAGGAATCCCTGG - Intergenic
964984875 3:162725999-162726021 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
965070324 3:163909777-163909799 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
965105234 3:164345595-164345617 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
965262657 3:166504261-166504283 GGAGGTTCTGGAGGAACACCTGG + Intergenic
965286737 3:166827579-166827601 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
965336324 3:167433449-167433471 GGCAGTTCTGGAGGAACACCTGG - Intergenic
965624886 3:170675998-170676020 GGTGGTTCTGGAGGAACACCTGG + Intronic
965626315 3:170686800-170686822 GGAGGTTCTGGAGGAACCCCTGG + Intronic
965640044 3:170821434-170821456 GGCGGTTCTGGAGGAACACCTGG + Intronic
965713403 3:171578648-171578670 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
965861975 3:173159384-173159406 GGAGGTTCTGGAGGAATCCCTGG + Intergenic
966009078 3:175053481-175053503 GGAGGATCTCGAGGACCCCCTGG - Intronic
966066840 3:175829948-175829970 AGAGGTTCTGGAGGAACGCCTGG - Intergenic
966085426 3:176063569-176063591 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
966105090 3:176325099-176325121 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
966232853 3:177669315-177669337 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
967005370 3:185378011-185378033 GGAGGTTCTGGAGGAACCCCTGG + Intronic
967212171 3:187179005-187179027 GGAGGTTCTGGAGGAACACCTGG + Intronic
967244172 3:187469747-187469769 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
967496216 3:190146739-190146761 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
967624654 3:191669963-191669985 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
967643834 3:191898845-191898867 AGCGGTTCTGGAGGAACACCTGG + Intergenic
967658111 3:192074561-192074583 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
967681463 3:192368928-192368950 GAAGGCTCTGGAGGACCCCTGGG - Intronic
967740481 3:192997917-192997939 GGAGGTTCTGAAGGAACCCCTGG - Intergenic
968993380 4:3929612-3929634 GAAGGTTCTGGAGTAACGCCTGG - Intergenic
969003817 4:4003692-4003714 GGCGGTTCTGGAGGAACGCCTGG + Intergenic
969174744 4:5389981-5390003 GTAGGTTCTGGAGGCTGCCCAGG - Intronic
969355273 4:6621308-6621330 GGAGTTCCTGGGGGAAGCCCTGG - Exonic
969654104 4:8486258-8486280 GGTGGTTCTGGAGGAACGCCTGG + Intronic
969656839 4:8503552-8503574 GGAGGGTTTGGTGGAACTCCTGG + Intergenic
969749050 4:9096493-9096515 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
969810110 4:9641133-9641155 GGCGGTTCTGGAGGAACACCTGG - Intergenic
970029239 4:11657209-11657231 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
970042084 4:11808507-11808529 GGCGGCTCTGGAGGGACGCCTGG - Intergenic
970087543 4:12365996-12366018 GATGGTTCTGGAGGAATGCCTGG - Intergenic
970256426 4:14174006-14174028 CGAGGTTCTGGAGGAATGCCTGG + Intergenic
970532730 4:16999896-16999918 GGCGGCTCTGGAGGAACGCCTGG - Intergenic
970854052 4:20633775-20633797 GGAGGTTCTGGAGGAACACCTGG + Intergenic
971123188 4:23725502-23725524 GGAGGTTCTAGAGGAACGCCTGG + Intergenic
971180559 4:24325444-24325466 GGAGGTTCTAGAGGAACACCTGG - Intergenic
971200136 4:24503241-24503263 GGAGGTTCTAGAGGAACGCCTGG - Intergenic
971552645 4:27976198-27976220 GGCGGTCCTGGAGGAATGCCTGG - Intergenic
972071143 4:35020262-35020284 GGCGGTCCTGGAGGAACACCTGG + Intergenic
973751121 4:54022038-54022060 AGAGGTTCTGGAGGAACCCCTGG - Intronic
974428404 4:61767768-61767790 GGAGGTTCTGGAGGAACGCCTGG + Intronic
975152119 4:71033765-71033787 GGATGTTTTGAAGGAGCCCCTGG - Intergenic
975865094 4:78717338-78717360 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
975933893 4:79557457-79557479 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
976558567 4:86476821-86476843 GGAGATTCTAGAGGAACCCCTGG - Intronic
976696532 4:87924099-87924121 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
976739962 4:88347227-88347249 GGAGGTCCTGAAGGAATGCCTGG + Intergenic
976884577 4:89968272-89968294 GGAGGTTCTGGAGGAACACCTGG + Intergenic
977010311 4:91626322-91626344 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
977012929 4:91658102-91658124 GGAGGTTCTGAAGGAATGCCTGG + Intergenic
977062514 4:92274970-92274992 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
977075211 4:92442441-92442463 GGAGGTTCTGGAGGAACGCCTGG + Intronic
977198433 4:94088104-94088126 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
977225348 4:94386948-94386970 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
977443358 4:97098473-97098495 GGAGGATCCTGAGGACCCCCCGG - Intergenic
978438605 4:108711258-108711280 GGAGGTTCTGGAGGAACACCTGG - Intergenic
979054628 4:115979133-115979155 GGAGGTTCTGGAGGAATGCGTGG + Intergenic
979146614 4:117254331-117254353 GGTGGTTCTGGAGGAACTCCTGG - Intergenic
979379936 4:119996152-119996174 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
979850312 4:125565116-125565138 GGAGATTCTGGAGGAACGCCTGG + Intergenic
979895163 4:126148616-126148638 GGAGGTTCTGGAGGAGCCCCTGG + Intergenic
980003358 4:127514926-127514948 GGAGGTTCTGGCGGAACCCCTGG + Intergenic
980284942 4:130769591-130769613 GGCGGTTCTGGAGGAACACCTGG - Intergenic
980388919 4:132120431-132120453 GGCGGTTCTGGAGGAACACCTGG - Intergenic
980472447 4:133267172-133267194 GGCGGTTCTGGAGGAACACCTGG + Intergenic
980527864 4:134014405-134014427 GGCAGTTCTGGAGGAACACCTGG - Intergenic
980575641 4:134681386-134681408 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
980611781 4:135170770-135170792 TGAGGTTCTGGAGGAATTGCTGG + Intergenic
980714417 4:136612511-136612533 AGAGGATTTGAAGGAACCCCTGG - Intergenic
980903933 4:138930102-138930124 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
980913718 4:139015829-139015851 GCAGGTTCTGGGGAAATCCCGGG - Exonic
981040238 4:140215725-140215747 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
981525204 4:145701331-145701353 GGAGGTTCTGGAGGAACGCCTGG - Intronic
981539719 4:145834976-145834998 GGAGGTTCTGGAGGAACGCCTGG - Intronic
982083973 4:151816082-151816104 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
982318804 4:154058511-154058533 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
982396724 4:154922318-154922340 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
982414202 4:155111941-155111963 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
982497110 4:156106946-156106968 GGAGGTTCTGGAGGAACACCTGG + Intergenic
982535441 4:156602513-156602535 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
983023866 4:162711333-162711355 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
983055482 4:163095319-163095341 GGAGGTTCTGGAGGAACACCTGG - Intergenic
983360401 4:166718531-166718553 GGAGGTTCTGGAGGAACACCTGG - Intergenic
983414714 4:167439284-167439306 GGAGGTTCTGGAGGAACACCTGG + Intergenic
983448054 4:167878501-167878523 GGTGGTTCTGGAGGAATGCCTGG - Intergenic
983452331 4:167925125-167925147 GAAGGTTCTGGAGGAAGGCCTGG - Intergenic
983659565 4:170118685-170118707 GGAGGTTCTGGAGGAAGGCCTGG - Intergenic
983707668 4:170679723-170679745 GGCGGTTCTGGAGGAACACCTGG - Intergenic
983805794 4:171989510-171989532 GGAGGTTCTGGAGGAACCCCTGG + Intronic
984099053 4:175464914-175464936 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
984165362 4:176298328-176298350 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
984393619 4:179168369-179168391 GGAGGTTCTGAAGGAACACCTGG + Intergenic
984700666 4:182816753-182816775 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
984956018 4:185046261-185046283 GGAGGATCCCGAGGACCCCCTGG - Intergenic
985057401 4:186047677-186047699 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
985389875 4:189482943-189482965 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
985582350 5:705021-705043 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
985861573 5:2475660-2475682 AGAGGTTCTGGAAGAAACCAGGG + Intergenic
986193530 5:5517786-5517808 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
986388874 5:7265816-7265838 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
986502633 5:8416327-8416349 GGAGGTCCTGGAGGAACACCTGG - Intergenic
986555048 5:9002025-9002047 GGCGGTTCTGGAGGAATGCCTGG + Intergenic
986905769 5:12492032-12492054 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
986919592 5:12666019-12666041 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
987282035 5:16422245-16422267 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
987486830 5:18535906-18535928 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
987487498 5:18540540-18540562 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
987498128 5:18672338-18672360 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
987755826 5:22097075-22097097 GGAGGTTCTGGAGGAAACTCTGG - Intronic
988737073 5:34033305-34033327 TGAAGTTCTGGTGGAATCCCCGG + Exonic
988810803 5:34783346-34783368 GGAGGATCCCGAGGACCCCCCGG - Intronic
989659921 5:43788346-43788368 GAAGGTCCTGGAGGAATGCCTGG - Intergenic
989688906 5:44118214-44118236 GGAGTTCCTGGAGGAATGCCTGG + Intergenic
989742762 5:44791916-44791938 GGAGGATCCCGAGGACCCCCTGG + Intergenic
989776315 5:45212085-45212107 GGAGTTGCTGGAGGAATCTCTGG + Intergenic
989970192 5:50514529-50514551 GGAGATGCTGGAGGCACCCTAGG + Intergenic
991921121 5:71657914-71657936 GGTTGTTGTGGAGGAACCTCTGG + Exonic
992394656 5:76359585-76359607 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
992452007 5:76883863-76883885 GGAGTTTCTGGAGGAACCCCTGG + Intronic
992960824 5:81955489-81955511 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
993192708 5:84700710-84700732 GGAGGTTCTGGAGGAACAGCTGG - Intergenic
993406308 5:87515753-87515775 GGAGGATCCCGAGGAACCCCCGG + Intergenic
993836701 5:92826206-92826228 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
994126112 5:96170353-96170375 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
994295142 5:98081296-98081318 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
994324870 5:98436799-98436821 GGAGGTCCTAGAGGAATGCCTGG - Intergenic
994375791 5:99014787-99014809 GGAGCTTCTGGAGGAACCCCTGG + Intergenic
994532551 5:100987733-100987755 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
994556932 5:101317167-101317189 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
994775679 5:104033848-104033870 GGAGATTCTGGAGGAACGCCTGG - Intergenic
994778952 5:104067667-104067689 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
994989548 5:106980611-106980633 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
995125165 5:108571936-108571958 GGAGGTTCTGAAGGAACCTCTGG + Intergenic
995296670 5:110532072-110532094 GGAGGTTCTGGAGGAATGCCTGG - Intronic
995769378 5:115652762-115652784 GGCAGTCCTGGAGGAACACCTGG - Intergenic
995899371 5:117049844-117049866 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
996203264 5:120701070-120701092 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
996344827 5:122477084-122477106 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
996358629 5:122622347-122622369 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
996509895 5:124306030-124306052 GGGGGTTCTGGAGGAACACTTGG - Intergenic
996528048 5:124499285-124499307 GGAGGTTCTGGAGGAAACTCTGG - Intergenic
996575004 5:124970076-124970098 GGAGGTTCTGGGGGAACCTCTGG + Intergenic
996725997 5:126673791-126673813 GGAGGTTTTGAAGGAGCCCCTGG + Intergenic
996745452 5:126843038-126843060 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
997442333 5:133917583-133917605 AGAGTCCCTGGAGGAACCCCAGG - Intergenic
997746395 5:136303544-136303566 GGAGGTTCTGGAGGAATGCCTGG - Intronic
997769686 5:136543092-136543114 GGAGGTTCTGGAGGAACGCGTGG + Intergenic
997772650 5:136568827-136568849 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
998995385 5:147865506-147865528 GGAGGTTCTGGAGGAACACCTGG - Intergenic
998996402 5:147872452-147872474 GGAGGTTCTGGAGGAACACCTGG + Intronic
999433161 5:151541190-151541212 GGAGGTTCTGTAGGAGCACTAGG + Intronic
999618875 5:153453189-153453211 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1000519411 5:162278856-162278878 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1000606924 5:163336255-163336277 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
1000885327 5:166742570-166742592 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1000935647 5:167301367-167301389 GGCAGTTCTGGAGGAATGCCTGG + Intronic
1001223983 5:169928104-169928126 GGAAGGCCTGAAGGAACCCCAGG - Intronic
1001331455 5:170765513-170765535 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1002610968 5:180418205-180418227 GGAGGTTCTGGGGGAACGCCTGG + Intergenic
1002714154 5:181215942-181215964 GGAGTTTCGGGAGGATCCTCCGG - Intergenic
1003430171 6:6031262-6031284 GGAGGTTCCCCAGGAACGCCTGG + Intergenic
1004106261 6:12669608-12669630 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1004283529 6:14300431-14300453 GGAGGTTCTGGAGGAACGTCTGG + Intergenic
1004508002 6:16262472-16262494 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1004575218 6:16888187-16888209 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1004768580 6:18757545-18757567 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1004836997 6:19541135-19541157 GGATGTTCTGGAGGAACACCTGG - Intergenic
1005014663 6:21364987-21365009 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1005786580 6:29250686-29250708 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
1006020042 6:31112439-31112461 GGAGGGACTGGAGGTCCCCCAGG - Intronic
1006038357 6:31232262-31232284 GGAGGATCCCGAGGACCCCCTGG - Intergenic
1006434877 6:34020898-34020920 GAAGGGACTGGAGGAACCCTAGG - Intronic
1007422927 6:41730353-41730375 GGAGAGTCTGGTGGAATCCCTGG + Intronic
1008171388 6:48211959-48211981 GGAGGTTCTTGTGGATTCCCAGG + Intergenic
1008648903 6:53544363-53544385 GGAGGCGCTCGAGGACCCCCGGG + Intronic
1008850219 6:56014294-56014316 GGAGGTTCTGGAGGAACTCCTGG + Intergenic
1009062474 6:58414287-58414309 GGAGGATCCTGAGGACCCCCCGG - Intergenic
1009243131 6:61203402-61203424 GGAGGTTCTGGGGCAACTCAGGG - Intergenic
1009269816 6:61602333-61602355 GGCGGTCCTGGAGGAATGCCTGG - Intergenic
1009343600 6:62588182-62588204 GGTGGTTCTGGAGGAATGTCTGG - Intergenic
1009379140 6:63007545-63007567 GGAAGATCTGGAGGAACCCCTGG - Intergenic
1010071730 6:71752027-71752049 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1010491143 6:76477439-76477461 GGAGGTCCTAGAGGAACTCCTGG - Intergenic
1010586702 6:77664035-77664057 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1010826917 6:80485917-80485939 GGAGGTTCTAGAGGAATGCCTGG + Intergenic
1010829697 6:80513785-80513807 GGCGGGCCTGGAGGAACACCTGG + Intergenic
1010861956 6:80923538-80923560 GGATTTTCTGGAGGCTCCCCAGG + Intergenic
1010894551 6:81348617-81348639 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1011770951 6:90673692-90673714 GGAGGTTCTGGAGGAAGGCCTGG + Intergenic
1012014395 6:93833558-93833580 GGAGGTTCTGGAGCAACGCCTGG + Intergenic
1012066548 6:94557424-94557446 GGAGGTTCTGGAGCAACGCCTGG + Intergenic
1012315820 6:97781829-97781851 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1012689570 6:102295156-102295178 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1013612438 6:111807755-111807777 GGGGGTTCTGAAGCACCCCCAGG + Intronic
1013843687 6:114425803-114425825 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1013891697 6:115034111-115034133 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1014115347 6:117663165-117663187 GGATGTTCTGGAGGAACCCCTGG + Intergenic
1014360166 6:120465746-120465768 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1014396063 6:120927420-120927442 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1014454876 6:121623919-121623941 GGAGGTTCTAGAGGAATGCCTGG + Intergenic
1014555842 6:122842059-122842081 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1014612078 6:123558872-123558894 GGAGGTTCTGGAGGAATCCCTGG - Intronic
1014718890 6:124894267-124894289 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1014793997 6:125705341-125705363 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1014891538 6:126850984-126851006 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1015165217 6:130194574-130194596 GGAGGTTCTGGAGAAATGCCTGG - Intronic
1015266729 6:131297686-131297708 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1015269651 6:131325633-131325655 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1015271368 6:131341112-131341134 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1015278147 6:131405043-131405065 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1015288047 6:131507762-131507784 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1015323824 6:131903916-131903938 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1015607676 6:134975801-134975823 GGAAATTCTGGAGGAAAACCTGG + Intronic
1015801382 6:137064805-137064827 GGAGATTCTGGAGGAACCCCTGG + Intergenic
1016114147 6:140260890-140260912 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1016204531 6:141455060-141455082 GGTGGTTCTGGAGGAACGCCTGG - Intergenic
1016248856 6:142018038-142018060 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1016518798 6:144925402-144925424 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1016535764 6:145106629-145106651 GGAGGTTCTCGAGGAACACCTGG + Intergenic
1017269809 6:152492444-152492466 GAAGGTCCTGGAGGAATGCCTGG - Intronic
1017389492 6:153923715-153923737 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1017779338 6:157704127-157704149 GGAGGTTCTGGAGGAACCCCTGG + Intronic
1018077591 6:160230725-160230747 GGAGGTTCTGGAGGAACCCCTGG - Intronic
1018084502 6:160290051-160290073 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1018471579 6:164101872-164101894 GCAAGTGCTGGAGGAACCCAAGG - Intergenic
1018495407 6:164342213-164342235 GGAGGTTCTGGAGGAACACCTGG + Intergenic
1018521474 6:164655631-164655653 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1018967583 6:168500577-168500599 GGTGATTCTGTAGGGACCCCGGG + Intronic
1019234067 6:170594660-170594682 GGAGGATCCTGAGGACCCCCTGG - Intergenic
1020316046 7:6906020-6906042 GGATGTTGCGGAGGAACGCCTGG - Intergenic
1020323949 7:6960147-6960169 GGCGGTTCTGGAGGAATGCCTGG + Intergenic
1020532720 7:9356899-9356921 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1020794209 7:12661797-12661819 GGAGGTCCTGGAGGAACCCCTGG - Intergenic
1021637311 7:22705474-22705496 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1021810658 7:24398507-24398529 AGAGGTTCTGGAGGAACGCCTGG - Intergenic
1022372867 7:29787077-29787099 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1022709065 7:32834624-32834646 GGAGATTCTGGAGGAACCCCTGG - Intergenic
1022710052 7:32841383-32841405 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1022854715 7:34303372-34303394 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1023698892 7:42874087-42874109 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1024101797 7:46039729-46039751 GGAGGATCTCGAGGACCTCCTGG - Intergenic
1024739258 7:52337125-52337147 GGAGGTCCTGAAGGAATGCCTGG + Intergenic
1026244822 7:68610662-68610684 GAAGTTTCTGGAAGATCCCCGGG + Intergenic
1026429262 7:70327336-70327358 GTAGCTTCTAGAGTAACCCCAGG + Intronic
1026776054 7:73231704-73231726 GGAGTGCCTGGAGGAAGCCCAGG + Intergenic
1026867963 7:73834928-73834950 GGAGGCTCTGGAGGCCACCCTGG - Exonic
1027016911 7:74785075-74785097 GGAGTGCCTGGAGGAAGCCCAGG + Intronic
1027071116 7:75160861-75160883 GGAGTGCCTGGAGGAAGCCCAGG - Intergenic
1027157881 7:75781383-75781405 GGAGGTTCTGGAGGAACCCCTGG - Intronic
1027158310 7:75784159-75784181 GGAGGTTCTGGAGGAACCCCTGG - Intronic
1027539548 7:79452095-79452117 GGAGGAGCTGGATGAAACCCTGG - Intronic
1027851939 7:83461895-83461917 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1028589916 7:92483268-92483290 GGTGGTCCTGGAGGAACGCCTGG + Intergenic
1028670504 7:93396161-93396183 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1028690172 7:93642091-93642113 GGAGGTTCTGGAGGAATGCCTGG - Intronic
1029317162 7:99725501-99725523 GGAGGTTTTGAAGGAGCCCCTGG - Intronic
1029500208 7:100924400-100924422 GGAGGTTCTGGAGGAATCCCTGG - Intergenic
1030163614 7:106531881-106531903 GAAGGTTCTGGAGGAACCCCTGG + Intergenic
1030441694 7:109595507-109595529 GGTGGTTCTGGAGGAATGCCTGG + Intergenic
1030548695 7:110931637-110931659 GGGGGTTCTGTAGTAACCCAGGG - Intronic
1030751504 7:113237058-113237080 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1031004662 7:116457714-116457736 GGAGGTTCTGGAGGAACGCCTGG - Intronic
1031139822 7:117930082-117930104 GGAGAGTCTGGAGGAGCTCCAGG + Intergenic
1031296609 7:120011118-120011140 GGTGGTTCTGGAGGAACACCTGG - Intergenic
1031355199 7:120780624-120780646 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1031364753 7:120889092-120889114 GGAGGTTCTGGAGGAAACTTCGG + Intergenic
1031399979 7:121317802-121317824 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1031422461 7:121567459-121567481 GGTGGTTCTGGAGGAACATCTGG + Intergenic
1031525586 7:122819151-122819173 GGAGGTTCTGGAGGAATGCCTGG - Intronic
1031685840 7:124731269-124731291 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1031727938 7:125262382-125262404 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1031776318 7:125912219-125912241 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1033084713 7:138331259-138331281 GGCAGTCCTGGAGGAACGCCTGG - Intergenic
1033088551 7:138364781-138364803 GGCGGTCCTGGAGGAACGCCTGG - Intergenic
1033211516 7:139463522-139463544 GGAAGTCCTGTAGGAACGCCTGG - Intronic
1033288353 7:140061533-140061555 GGATGTTGTGGGGGAACCACTGG - Intronic
1033465040 7:141582265-141582287 GGTGGTCCTGGAGGAATGCCTGG + Intronic
1033543821 7:142381659-142381681 GTGGGTACTGGAGGAAACCCTGG - Intergenic
1033675957 7:143540702-143540724 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1033695878 7:143788737-143788759 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1033909474 7:146246859-146246881 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1034084839 7:148313530-148313552 GAAGGTTCTGGAGGAATCCCTGG + Intronic
1035227122 7:157439787-157439809 GGAGGTGATGGAGGTGCCCCTGG - Intergenic
1035297811 7:157876986-157877008 GCAGTCCCTGGAGGAACCCCAGG + Intronic
1035395191 7:158530387-158530409 GGAGGCTCTGCAGGAGCTCCTGG + Intronic
1035424377 7:158758333-158758355 GAAGGTGCTGGAGGAAGCCAAGG + Intronic
1035636708 8:1152631-1152653 GGAGGCCCTGCAGGCACCCCTGG - Intergenic
1035880669 8:3241696-3241718 GGTGTTTCTGGAGGAACGCCTGG + Intronic
1036281476 8:7404668-7404690 GGAGGTTCTGGAGGACTGCCTGG - Intergenic
1036339993 8:7906904-7906926 GGAGGTTCTGGAGGACTGCCTGG + Intergenic
1036372126 8:8170837-8170859 GGTGGTTCTGGAGGAATGCCTGG - Intergenic
1036398924 8:8391154-8391176 GGAGGTTCTAAAGGACCCCATGG + Intergenic
1036472336 8:9062915-9062937 GGAGGTTCTGGAGGAACCCCTGG + Intronic
1036549654 8:9805173-9805195 GGAAGTTTTGAAGGAGCCCCGGG - Intergenic
1036639488 8:10573499-10573521 GGTGGTTCTGGAGGAATGCCTGG - Intergenic
1036878775 8:12494804-12494826 GGTGGTTCTGGAGGAATGCCTGG + Intergenic
1037408185 8:18566024-18566046 TGAGGTACTGGAGGAATCCTAGG + Intronic
1037812982 8:22097701-22097723 GGAGTTTCTGGAAGAGCACCAGG - Exonic
1039498078 8:37996480-37996502 GGAAGTGCTGGGGGAGCCCCAGG - Intergenic
1041917539 8:63151777-63151799 GGAAGTTCTGGAGGAACCCCTGG + Intergenic
1042453551 8:68975402-68975424 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
1042707363 8:71677142-71677164 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
1043353677 8:79389585-79389607 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1043717903 8:83508621-83508643 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1043720900 8:83546200-83546222 GGAGGCCCTGGAGGAACACCTGG - Intergenic
1043837731 8:85065203-85065225 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1043946682 8:86261556-86261578 GGAGGTTCTGAATGCTCCCCAGG + Intronic
1044148521 8:88745695-88745717 GGAGTTTCTGGAGGAACGTCTGG + Intergenic
1044258621 8:90093684-90093706 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1044417078 8:91950198-91950220 GGAGGTTCTGGAGGAACACCTGG - Intergenic
1044921985 8:97177305-97177327 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1044925152 8:97203149-97203171 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1045190304 8:99875532-99875554 GGAGGTTCTGCAGCCACCACAGG - Exonic
1045197516 8:99946100-99946122 GAAGGTTCTGGAGGAACACCTGG - Intergenic
1045290370 8:100827670-100827692 AGAGGGCCAGGAGGAACCCCTGG + Intergenic
1045472938 8:102528503-102528525 GCAGATTCTGGAGGAAGTCCTGG - Intergenic
1045644775 8:104288164-104288186 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1046074902 8:109303041-109303063 GGCGGTCCTGGAGGAACACCTGG - Intronic
1046294113 8:112198053-112198075 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1046386348 8:113512993-113513015 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1046440006 8:114243567-114243589 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1046443241 8:114284222-114284244 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1046512078 8:115214456-115214478 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1046559278 8:115816838-115816860 GGAGGTTCTAGAGGAACGCCTGG - Intergenic
1047699340 8:127433958-127433980 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1047829549 8:128615388-128615410 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1047856366 8:128916649-128916671 GGCGGGCCTGGAGGAACACCTGG - Intergenic
1048135465 8:131742951-131742973 GGTGCTTCTGGGGGAACCCCTGG - Intergenic
1048143766 8:131821415-131821437 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1048168439 8:132083717-132083739 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1048585426 8:135770621-135770643 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1048728426 8:137411755-137411777 GGCGGTTCTGGAGGAATGCCTGG + Intergenic
1048764241 8:137828296-137828318 AGTGGTTCTGGAGGAACGCCTGG + Intergenic
1049199614 8:141333613-141333635 GGAGGGGCTGGAGGAAAGCCTGG + Intergenic
1049748233 8:144271997-144272019 GCCAGGTCTGGAGGAACCCCTGG - Intronic
1049868825 8:144957739-144957761 GGAGGTCCTGGAGGAACTCCTGG + Intergenic
1050117595 9:2277797-2277819 GGCGGGCCTGGAGGAACGCCTGG - Intergenic
1050140475 9:2511664-2511686 GGAGGTCCTGGAGGAACACCTGG - Intergenic
1050258111 9:3814631-3814653 GGCAGTTCTGGAGGAACGCCTGG + Intergenic
1051052620 9:12950552-12950574 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1051849291 9:21489181-21489203 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1052653328 9:31328645-31328667 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1053134667 9:35643082-35643104 GGAGGTTTTGAAGGAGCCCCTGG - Intronic
1053380908 9:37649544-37649566 GGAGTTTCTGGATGGACTCCTGG + Intronic
1054807493 9:69408232-69408254 GGCAGTTCTGGAGGAACGCCTGG + Intergenic
1055233056 9:74087894-74087916 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1055347725 9:75355260-75355282 GGTGGGCCTGGAGGAACACCTGG + Intergenic
1055810040 9:80139642-80139664 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1055881741 9:81011238-81011260 GGCGGTTCTGGAGGAACGCCTGG - Intergenic
1056044743 9:82704191-82704213 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1056061153 9:82885988-82886010 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1056323879 9:85460877-85460899 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1056363703 9:85882916-85882938 GGTGGTCCTGGAGGAACGCCTGG - Intergenic
1056522441 9:87413157-87413179 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1056882974 9:90414806-90414828 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1057234840 9:93349836-93349858 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1057377987 9:94542058-94542080 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1057669503 9:97076233-97076255 TGTGGGTCTGGAGGAACCCGGGG + Intergenic
1057683996 9:97217074-97217096 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1057812586 9:98269290-98269312 GGAGGTTCTGAAGGAAACTCTGG + Intergenic
1057982077 9:99672390-99672412 GGAGGTTCTGGAGGAACTCCTGG - Intergenic
1058026212 9:100144173-100144195 GGAGGTTCTGGAGGAACTCCTGG + Intronic
1058110615 9:101028301-101028323 AGAGGTCCAGGAGGAACCACAGG - Intergenic
1058612396 9:106790428-106790450 GGTGGTTCTGGAGGAACGCCTGG - Intergenic
1059066767 9:111093779-111093801 AGAGGTTTTGGAGAAACCTCTGG - Intergenic
1059546164 9:115178099-115178121 GGAGGTTCTGGAGGAACCCCTGG + Intronic
1059574616 9:115475590-115475612 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1059606713 9:115842684-115842706 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1059863492 9:118489153-118489175 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1060737888 9:126078107-126078129 GGCAGTTCTGGAGGAATGCCTGG + Intergenic
1061160694 9:128892329-128892351 GGAGCTGCTGGGGGAAGCCCAGG + Intronic
1061583062 9:131549317-131549339 AGAGGTTCTGGAGGAATGCCTGG - Intergenic
1061601769 9:131675010-131675032 GGGGGTTCTGGAGGAGCAGCTGG + Intronic
1062691575 9:137844973-137844995 GGATGTTTTGAAGGAGCCCCTGG - Intronic
1185468522 X:369106-369128 GGGGGTTCTGAAGGAATCACAGG + Intronic
1185858435 X:3556603-3556625 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1185960693 X:4543963-4543985 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1185991055 X:4893823-4893845 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1186112870 X:6275657-6275679 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1186784062 X:12942054-12942076 GGCGGTTCTGGAGGAATGCCTGG - Intergenic
1187086528 X:16048166-16048188 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1187099963 X:16182636-16182658 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1187778016 X:22785815-22785837 GGAGGTTCTCCAGGCACCTCTGG + Intergenic
1188333025 X:28896069-28896091 GGAGGTTCTGGAGGAACCCCTGG + Intronic
1188463380 X:30452573-30452595 GGAGGTTCTGGAGGAAGGCCTGG + Intergenic
1191014201 X:55791785-55791807 GGCGGTCCTGGAGGAACGCCTGG + Intergenic
1192454593 X:71266414-71266436 GGAAGTCCTGGAGGAACTCCTGG - Intergenic
1192706138 X:73529897-73529919 GGATGTCCTGGAGGAACTCCTGG - Intergenic
1192764591 X:74128289-74128311 GGAGGTTTTGAAGGAGCCCCTGG + Intergenic
1192914136 X:75635744-75635766 GGAGGTCCTGGAGGAATGCCTGG + Intergenic
1193885924 X:86984037-86984059 GGAGATTCTGGAGGAACACCTGG - Intergenic
1193941492 X:87684121-87684143 GGAGGTTCTGGAGGAAGGCCTGG - Intergenic
1194186254 X:90776796-90776818 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1194293630 X:92103714-92103736 GAAGGTTCTGGAGGAACGCCTGG + Intronic
1194308546 X:92276537-92276559 GGAGGTTCTGGAGGAATGCCTGG + Intronic
1194351284 X:92826723-92826745 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1194367101 X:93025165-93025187 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1194502987 X:94702297-94702319 GGCGGTACTGGAGGAACGCCTGG + Intergenic
1194660682 X:96626258-96626280 GGAGGTTCTGGAGGAAGGCCTGG - Intergenic
1194822773 X:98527749-98527771 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1194873806 X:99162915-99162937 GGAGGTTCTGGAGGAAGGCCTGG + Intergenic
1195016958 X:100789898-100789920 GGCAGTCCTGGAGGAACGCCTGG + Intergenic
1195291161 X:103433007-103433029 GGTGGTCCTGGAGGAATGCCTGG + Intergenic
1195326863 X:103765253-103765275 GGTGGTCCTGGAGGAATGCCTGG + Intergenic
1195841480 X:109180653-109180675 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1195908682 X:109868693-109868715 GGAGGTTCTGGAGGAACGCCTGG + Intergenic
1196073077 X:111546149-111546171 GGAGGTTCTGGAGGAATGCTTGG - Intergenic
1196165539 X:112532848-112532870 GGAGGTTCTGGAGGAACGTCTGG - Intergenic
1196227223 X:113180278-113180300 GGAGGTTCTGGAGGAACCCCTGG + Intergenic
1196300006 X:114042215-114042237 GGCGGTTCTGGAGGAACGCCTGG - Intergenic
1196330819 X:114468995-114469017 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1196341721 X:114604780-114604802 GGAGGTTCTGGAGGAATGCCTGG + Intronic
1196472046 X:116039658-116039680 GGAGGATCCTGAGGACCCCCTGG + Intergenic
1196533545 X:116815942-116815964 GGAGTTTCTGGAGGAACGCCTGG + Intergenic
1196572494 X:117281391-117281413 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1196585119 X:117419895-117419917 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1196773858 X:119321243-119321265 GGAGTTTCTGGAGGAACGCCTGG + Intergenic
1196992691 X:121346467-121346489 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1197064911 X:122224267-122224289 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1197352065 X:125392323-125392345 GGGGGTTCTGGACGAATGCCTGG + Intergenic
1197717364 X:129719184-129719206 GGAGGTTCTAGGGGAACCTCTGG - Intergenic
1197793633 X:130279267-130279289 GGAGGTCCTGGAGGAATGCCTGG - Intergenic
1197933077 X:131714304-131714326 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1198599405 X:138267787-138267809 GGAGGTTCTGGAGGAATGTCTGG + Intergenic
1198965918 X:142228782-142228804 GGAGGTTCTGGAGGAACCCCTGG - Intergenic
1199576476 X:149317898-149317920 GGAGGTTCTGGAGGAACGCCTGG - Intergenic
1200007829 X:153099484-153099506 GGAGGTTTTGAAGGAGCCCCTGG + Intergenic
1200153971 X:153965513-153965535 GGAGGTTTTCGGGGAAGCCCTGG - Intronic
1200532844 Y:4358875-4358897 GGAGGTTCTGGAGGAATGCCTGG + Intergenic
1200611149 Y:5328260-5328282 GGAGGTTCTGGAGGAACGCCTGG + Intronic
1200659609 Y:5943413-5943435 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1200675315 Y:6141421-6141443 GGAGGTTCTGGAGGAATGCCTGG - Intergenic
1201370472 Y:13257755-13257777 GGAGGATCCTGAGGATCCCCCGG + Intronic
1201473509 Y:14357874-14357896 GGAGTTCCTGGAGGAACACTTGG + Intergenic
1201581385 Y:15514607-15514629 GGAGGTTCTGGAGGAATGCCTGG - Intergenic