ID: 951891810

View in Genome Browser
Species Human (GRCh38)
Location 3:27574617-27574639
Sequence GAGAAGCCATAGGCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951891810_951891812 -8 Left 951891810 3:27574617-27574639 CCAGCTGGGGCCTATGGCTTCTC No data
Right 951891812 3:27574632-27574654 GGCTTCTCAAGATGTCAAACAGG No data
951891810_951891813 -7 Left 951891810 3:27574617-27574639 CCAGCTGGGGCCTATGGCTTCTC No data
Right 951891813 3:27574633-27574655 GCTTCTCAAGATGTCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951891810 Original CRISPR GAGAAGCCATAGGCCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr