ID: 951891813

View in Genome Browser
Species Human (GRCh38)
Location 3:27574633-27574655
Sequence GCTTCTCAAGATGTCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951891804_951891813 9 Left 951891804 3:27574601-27574623 CCAAACATGTGTTCTCCCAGCTG No data
Right 951891813 3:27574633-27574655 GCTTCTCAAGATGTCAAACAGGG No data
951891810_951891813 -7 Left 951891810 3:27574617-27574639 CCAGCTGGGGCCTATGGCTTCTC No data
Right 951891813 3:27574633-27574655 GCTTCTCAAGATGTCAAACAGGG No data
951891809_951891813 -6 Left 951891809 3:27574616-27574638 CCCAGCTGGGGCCTATGGCTTCT No data
Right 951891813 3:27574633-27574655 GCTTCTCAAGATGTCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951891813 Original CRISPR GCTTCTCAAGATGTCAAACA GGG Intergenic
No off target data available for this crispr