ID: 951895996

View in Genome Browser
Species Human (GRCh38)
Location 3:27610212-27610234
Sequence ATTGACGATGGAGGTGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951895996_951896004 26 Left 951895996 3:27610212-27610234 CCATTTACACCTCCATCGTCAAT No data
Right 951896004 3:27610261-27610283 TTTTATCTGAGGCCTGCTGTAGG No data
951895996_951896002 15 Left 951895996 3:27610212-27610234 CCATTTACACCTCCATCGTCAAT No data
Right 951896002 3:27610250-27610272 CCTCCTTTAGTTTTTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951895996 Original CRISPR ATTGACGATGGAGGTGTAAA TGG (reversed) Intergenic
No off target data available for this crispr