ID: 951895997

View in Genome Browser
Species Human (GRCh38)
Location 3:27610221-27610243
Sequence GGTAAACACATTGACGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951895997_951896002 6 Left 951895997 3:27610221-27610243 CCTCCATCGTCAATGTGTTTACC No data
Right 951896002 3:27610250-27610272 CCTCCTTTAGTTTTTATCTGAGG No data
951895997_951896005 28 Left 951895997 3:27610221-27610243 CCTCCATCGTCAATGTGTTTACC No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data
951895997_951896004 17 Left 951895997 3:27610221-27610243 CCTCCATCGTCAATGTGTTTACC No data
Right 951896004 3:27610261-27610283 TTTTATCTGAGGCCTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951895997 Original CRISPR GGTAAACACATTGACGATGG AGG (reversed) Intergenic
No off target data available for this crispr