ID: 951896002

View in Genome Browser
Species Human (GRCh38)
Location 3:27610250-27610272
Sequence CCTCCTTTAGTTTTTATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951895996_951896002 15 Left 951895996 3:27610212-27610234 CCATTTACACCTCCATCGTCAAT No data
Right 951896002 3:27610250-27610272 CCTCCTTTAGTTTTTATCTGAGG No data
951895998_951896002 3 Left 951895998 3:27610224-27610246 CCATCGTCAATGTGTTTACCACT No data
Right 951896002 3:27610250-27610272 CCTCCTTTAGTTTTTATCTGAGG No data
951895997_951896002 6 Left 951895997 3:27610221-27610243 CCTCCATCGTCAATGTGTTTACC No data
Right 951896002 3:27610250-27610272 CCTCCTTTAGTTTTTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951896002 Original CRISPR CCTCCTTTAGTTTTTATCTG AGG Intergenic
No off target data available for this crispr