ID: 951896004

View in Genome Browser
Species Human (GRCh38)
Location 3:27610261-27610283
Sequence TTTTATCTGAGGCCTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951895996_951896004 26 Left 951895996 3:27610212-27610234 CCATTTACACCTCCATCGTCAAT No data
Right 951896004 3:27610261-27610283 TTTTATCTGAGGCCTGCTGTAGG No data
951895999_951896004 -4 Left 951895999 3:27610242-27610264 CCACTCTCCCTCCTTTAGTTTTT No data
Right 951896004 3:27610261-27610283 TTTTATCTGAGGCCTGCTGTAGG No data
951895997_951896004 17 Left 951895997 3:27610221-27610243 CCTCCATCGTCAATGTGTTTACC No data
Right 951896004 3:27610261-27610283 TTTTATCTGAGGCCTGCTGTAGG No data
951895998_951896004 14 Left 951895998 3:27610224-27610246 CCATCGTCAATGTGTTTACCACT No data
Right 951896004 3:27610261-27610283 TTTTATCTGAGGCCTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951896004 Original CRISPR TTTTATCTGAGGCCTGCTGT AGG Intergenic
No off target data available for this crispr