ID: 951896005

View in Genome Browser
Species Human (GRCh38)
Location 3:27610272-27610294
Sequence GCCTGCTGTAGGACAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951896000_951896005 0 Left 951896000 3:27610249-27610271 CCCTCCTTTAGTTTTTATCTGAG No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data
951895999_951896005 7 Left 951895999 3:27610242-27610264 CCACTCTCCCTCCTTTAGTTTTT No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data
951896001_951896005 -1 Left 951896001 3:27610250-27610272 CCTCCTTTAGTTTTTATCTGAGG No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data
951895997_951896005 28 Left 951895997 3:27610221-27610243 CCTCCATCGTCAATGTGTTTACC No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data
951896003_951896005 -4 Left 951896003 3:27610253-27610275 CCTTTAGTTTTTATCTGAGGCCT No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data
951895998_951896005 25 Left 951895998 3:27610224-27610246 CCATCGTCAATGTGTTTACCACT No data
Right 951896005 3:27610272-27610294 GCCTGCTGTAGGACAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951896005 Original CRISPR GCCTGCTGTAGGACAGTTTC TGG Intergenic
No off target data available for this crispr