ID: 951902202

View in Genome Browser
Species Human (GRCh38)
Location 3:27667896-27667918
Sequence AGAACAATGGGATAAGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951902202_951902212 8 Left 951902202 3:27667896-27667918 CCTTATGCTTATCCCATTGTTCT No data
Right 951902212 3:27667927-27667949 AAGGTCACAGGATATACATGGGG No data
951902202_951902211 7 Left 951902202 3:27667896-27667918 CCTTATGCTTATCCCATTGTTCT No data
Right 951902211 3:27667926-27667948 CAAGGTCACAGGATATACATGGG No data
951902202_951902213 15 Left 951902202 3:27667896-27667918 CCTTATGCTTATCCCATTGTTCT No data
Right 951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG No data
951902202_951902210 6 Left 951902202 3:27667896-27667918 CCTTATGCTTATCCCATTGTTCT No data
Right 951902210 3:27667925-27667947 GCAAGGTCACAGGATATACATGG No data
951902202_951902209 -4 Left 951902202 3:27667896-27667918 CCTTATGCTTATCCCATTGTTCT No data
Right 951902209 3:27667915-27667937 TTCTGGGAAGGCAAGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951902202 Original CRISPR AGAACAATGGGATAAGCATA AGG (reversed) Intergenic
No off target data available for this crispr