ID: 951902206

View in Genome Browser
Species Human (GRCh38)
Location 3:27667908-27667930
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951902206_951902213 3 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG No data
951902206_951902215 28 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902215 3:27667959-27667981 AAACAACAGTTGAGACTGCTGGG No data
951902206_951902210 -6 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902210 3:27667925-27667947 GCAAGGTCACAGGATATACATGG No data
951902206_951902214 27 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902214 3:27667958-27667980 GAAACAACAGTTGAGACTGCTGG No data
951902206_951902211 -5 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902211 3:27667926-27667948 CAAGGTCACAGGATATACATGGG No data
951902206_951902212 -4 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902212 3:27667927-27667949 AAGGTCACAGGATATACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951902206 Original CRISPR CCTTGCCTTCCCAGAACAAT GGG (reversed) Intergenic
No off target data available for this crispr