ID: 951902213

View in Genome Browser
Species Human (GRCh38)
Location 3:27667934-27667956
Sequence CAGGATATACATGGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951902202_951902213 15 Left 951902202 3:27667896-27667918 CCTTATGCTTATCCCATTGTTCT No data
Right 951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG No data
951902206_951902213 3 Left 951902206 3:27667908-27667930 CCCATTGTTCTGGGAAGGCAAGG No data
Right 951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG No data
951902208_951902213 2 Left 951902208 3:27667909-27667931 CCATTGTTCTGGGAAGGCAAGGT No data
Right 951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951902213 Original CRISPR CAGGATATACATGGGGAAAG AGG Intergenic
No off target data available for this crispr