ID: 951904673

View in Genome Browser
Species Human (GRCh38)
Location 3:27692880-27692902
Sequence GTGTGTCCTTGCCATGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951904673_951904675 9 Left 951904673 3:27692880-27692902 CCTGCAACATGGCAAGGACACAC No data
Right 951904675 3:27692912-27692934 AGTGTTATTCAACATAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951904673 Original CRISPR GTGTGTCCTTGCCATGTTGC AGG (reversed) Intergenic
No off target data available for this crispr