ID: 951907095

View in Genome Browser
Species Human (GRCh38)
Location 3:27716178-27716200
Sequence CAGAATATTCCCAAATATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951907095 Original CRISPR CAGAATATTCCCAAATATCA TGG Intronic
905510121 1:38512806-38512828 CAGAGTCTTTCCAAATGTCAGGG - Intergenic
905965093 1:42086088-42086110 CAGAATATTCCAAGTTCTCAAGG - Intergenic
910540329 1:88348172-88348194 TAGAATCTTCCCAAATATCCAGG - Intergenic
910638231 1:89432509-89432531 CTAATTATTGCCAAATATCATGG - Intergenic
911789490 1:101995237-101995259 AAGAATATTCCCAAATCATATGG + Intronic
912389185 1:109290170-109290192 TTGTATATTCCCAAATTTCATGG - Intergenic
917645642 1:177026202-177026224 CAGAATATTTCCATCTATCAAGG - Intronic
917867473 1:179211118-179211140 TAGAATTTTTCCAAATATCAGGG + Intronic
918203432 1:182288479-182288501 CAGAAGATGCCCAAATCCCAAGG + Intergenic
918655368 1:187019376-187019398 CAGAATTCACCCAAATATAACGG + Intergenic
918957871 1:191234800-191234822 CAGAATATTACAGAATATTAAGG + Intergenic
920208133 1:204307947-204307969 GAGAATATTCCCTAATATGGAGG - Intronic
920259725 1:204680658-204680680 CAGAACATTCCCACATGTCTTGG - Intronic
920523416 1:206646861-206646883 AAGTATCTTCCCAAATATTAAGG - Intronic
921979076 1:221235518-221235540 CAAAACATTCCCAATTAGCATGG - Intergenic
923746013 1:236700865-236700887 CAGAACATTCCCAGATATGTGGG - Intronic
924874354 1:248084690-248084712 TAGAAAATTCACAAATGTCATGG + Intronic
1063928794 10:11008305-11008327 GTGAATATTCCCAAAGCTCATGG - Intronic
1064094619 10:12414073-12414095 TACAATTTTCCCAACTATCAGGG - Intronic
1066616838 10:37303373-37303395 CATAATCTTCCCAAATAACATGG + Intronic
1068258120 10:54540607-54540629 AAAACTATTCCAAAATATCAAGG + Intronic
1068397542 10:56483806-56483828 CAGAGTAGTCCTAAATATGAGGG + Intergenic
1068747877 10:60555806-60555828 GGGAAAATTCCCACATATCAGGG - Intronic
1070277735 10:75023564-75023586 GAGAATTTTCCCTAATATGAGGG - Intronic
1072482726 10:95825410-95825432 CAGGATCATCCCAAATATCATGG + Intronic
1072718106 10:97764996-97765018 AAGAATCTTCCCAAAGACCAGGG - Intergenic
1074095953 10:110312680-110312702 CAGAATACTCCAAAATATTTTGG + Intergenic
1075291316 10:121233484-121233506 CAGAATTTTCCCAATGATCAAGG + Intergenic
1075354436 10:121757867-121757889 CAGAATACACACAAATATGAGGG - Intronic
1075619982 10:123919354-123919376 CATAATATTCAAAAATATCCAGG + Intronic
1077650308 11:3965558-3965580 CAGAATACACCCAAAGATTAAGG - Intronic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1079183907 11:18219606-18219628 CAAAATATTCCAAAATATAGAGG + Intronic
1079798803 11:24843703-24843725 CACACAATTCCCACATATCATGG + Intronic
1079863078 11:25698722-25698744 GAAAATATTCCCAAAAATGAAGG + Intergenic
1081293326 11:41353471-41353493 GAAAATATTCCCAAATATCAAGG + Intronic
1081856107 11:46304931-46304953 CACAATCTTCCCAAATTACAGGG - Intronic
1086659803 11:89401353-89401375 CATAATATTCACAAATATTAGGG - Intronic
1086755917 11:90561750-90561772 AAAACTATTCCCAAAAATCAAGG + Intergenic
1088493596 11:110410696-110410718 GAGCATATTCACAAATTTCAAGG - Intergenic
1088645643 11:111914070-111914092 CTGAATAAACCCAAATCTCAGGG + Exonic
1088806222 11:113354999-113355021 AAAACTATTCCAAAATATCAAGG - Intronic
1089095569 11:115917513-115917535 CAAAATATTCCTAAAGGTCATGG - Intergenic
1090142933 11:124284559-124284581 GAAACTATTCCAAAATATCAAGG + Intergenic
1090975826 11:131679163-131679185 CAGCAGATTCCCAAATGTCAGGG - Intronic
1092777201 12:11954141-11954163 CACAATATCCCTAAGTATCATGG + Intergenic
1092906988 12:13109992-13110014 GAGACTATTCCAAAATATCAAGG - Intronic
1093618323 12:21255599-21255621 CAAAATATTTACAAATTTCAGGG + Intergenic
1094600663 12:31906360-31906382 CAGCATATTCCCAAATGAAATGG - Intergenic
1096333105 12:50731878-50731900 CAGAATATCTCCAAAGATAAGGG + Intronic
1096761412 12:53844912-53844934 CCCAAGATACCCAAATATCAGGG + Intergenic
1097507071 12:60486802-60486824 ATAAAAATTCCCAAATATCAGGG - Intergenic
1098632406 12:72740415-72740437 CAGGATAATCTCTAATATCAGGG + Intergenic
1099778472 12:87164563-87164585 CAGAAGATATCCAAATATTATGG - Intergenic
1100217076 12:92462264-92462286 CAGAATCTTCCCCTATCTCATGG + Intergenic
1100630338 12:96382462-96382484 GAAACTATTCCAAAATATCAAGG + Intronic
1102762483 12:115400318-115400340 CAGAATCTTCCCAGATCTGATGG + Intergenic
1105658962 13:22471654-22471676 CAGACTATTCTCAAACATGATGG + Intergenic
1105873427 13:24530689-24530711 CAGAACATGCCAAAATATCTGGG + Intergenic
1107511412 13:41089587-41089609 CTGAAAATTCCCAAATATTTGGG - Intergenic
1109897288 13:68710043-68710065 CAGAATATTCTCATATTTAAAGG + Intergenic
1110139825 13:72114820-72114842 CAGGATATTCCCAGGTTTCAGGG - Intergenic
1110299596 13:73910686-73910708 CTGAATATTACCAAATAACCAGG + Intronic
1110854535 13:80281863-80281885 CAGAATATTCCTCAGTTTCAGGG + Intergenic
1110992927 13:82067054-82067076 CAGAATTTTCCACAATGTCATGG + Intergenic
1111597540 13:90430302-90430324 TGGAAAATTCCCAAATATCTGGG - Intergenic
1111668008 13:91294250-91294272 CAGAATGTTTCCAGAAATCATGG + Intergenic
1112636604 13:101223870-101223892 CAGCATATTCCCAAATGAAATGG - Intronic
1113140446 13:107142660-107142682 TAGAATCTTACCTAATATCATGG - Intergenic
1113244056 13:108375377-108375399 AATAAAATTCCCAAAGATCAAGG - Intergenic
1113865887 13:113523244-113523266 CAGAATTCTACCAAATATTAAGG - Intronic
1114277451 14:21159552-21159574 TAGAAAATTCCCAAATATTTGGG - Intergenic
1114277915 14:21164686-21164708 TAGAAAATTCCCAAATATTTGGG + Intergenic
1114436218 14:22709782-22709804 CTGGATATTACAAAATATCACGG + Intergenic
1115176716 14:30570381-30570403 CAAAAACTTCCCAAATTTCATGG - Intronic
1115774763 14:36702989-36703011 CAGAATATTGTCACATATCCTGG + Intronic
1115930316 14:38483857-38483879 CACGAAATTCCCAAAGATCAAGG + Intergenic
1116131728 14:40862837-40862859 GAAACTATTCCCAAATATCAAGG - Intergenic
1117406618 14:55410591-55410613 CAAAACATTCCCAAATATAGAGG + Intronic
1118237591 14:64023305-64023327 GATAATATTCCCAAATAACTTGG + Intronic
1120422525 14:84306086-84306108 GAAACTATTCCCAAAAATCAAGG + Intergenic
1122572593 14:102717045-102717067 CAAAAAAGTACCAAATATCATGG - Intronic
1124896699 15:33784185-33784207 CAGAATAATCCCAGCTATCTTGG - Intronic
1125311247 15:38380271-38380293 CCTAATATTCACAAATATCCAGG + Intergenic
1127988141 15:64091191-64091213 CAGAATTTTGCCAAACATGACGG + Intronic
1128965066 15:72050748-72050770 CACCATATTCCCAAATATTTGGG + Intronic
1130762809 15:86838120-86838142 CAAAAAATTCCCAAATGGCAAGG - Intronic
1132013775 15:98298539-98298561 CAGAATGTTCCCAACTAGAATGG + Intergenic
1132016254 15:98320121-98320143 CAGGATATACCCAAATGCCAAGG + Intergenic
1132077751 15:98836778-98836800 CATACTATTCAAAAATATCAAGG - Intronic
1134299358 16:12975773-12975795 AAGAATCTTTCCAAATATCTGGG - Intronic
1134756968 16:16675678-16675700 CAGAATATCCAAAAATAACAGGG - Intergenic
1134989100 16:18683485-18683507 CAGAATATCCAAAAATAACAGGG + Intergenic
1137546120 16:49404930-49404952 AAGATTATTCCCAGGTATCAGGG + Intergenic
1138163733 16:54780292-54780314 CAAAATATTCCCAGAAATGAAGG - Intergenic
1139763772 16:69209298-69209320 CAAAATCTTCCCAAACAGCATGG - Intronic
1140674606 16:77315573-77315595 CAGGATCTTCACAGATATCATGG - Intronic
1143715165 17:8762342-8762364 CACAAAATTCCCACATGTCATGG - Intergenic
1145007502 17:19345875-19345897 CAGAATCTTCCCAGATATGGAGG - Intronic
1147129387 17:38397913-38397935 CAGCCGATACCCAAATATCAAGG + Intronic
1148374557 17:47130935-47130957 CAGAACTTTAACAAATATCATGG + Intronic
1150159435 17:62883224-62883246 CACACTATTCCCAAATATATGGG - Intergenic
1151102373 17:71570773-71570795 CTGAACATTCCCAAATTTCCAGG + Intergenic
1151882916 17:76905604-76905626 CAGAACATTCCCAACTTTCCAGG - Intronic
1153507473 18:5816176-5816198 CAGAATATACCAGAATATCTGGG + Intergenic
1156554125 18:38048195-38048217 CAGAATTTCCCTAAATATTAAGG - Intergenic
1156680482 18:39582607-39582629 CAGACTATTGCCAAATATATGGG + Intergenic
1157172406 18:45419961-45419983 CAGATTGTTCCAAAATATAATGG + Intronic
1158299046 18:56032121-56032143 CTGAATCTTCCCAACTATGAGGG + Intergenic
1158662546 18:59401612-59401634 CAGCATTATCCTAAATATCATGG - Intergenic
1159247261 18:65823562-65823584 CATAAAATTCCAAAATGTCAGGG - Intronic
1159572002 18:70125703-70125725 TAGAAGATTCCCATAAATCATGG - Intronic
1160315132 18:77836762-77836784 TAGAATATTTCAAAAAATCAAGG + Intergenic
1166171665 19:41031958-41031980 CAAAAGATTCCAAAATGTCAGGG + Intergenic
1166598870 19:44075813-44075835 CACAAAATTCCTAAAAATCACGG - Intronic
925727723 2:6889994-6890016 CACCATATTCCTAAATTTCAGGG + Intronic
925812645 2:7715886-7715908 TAGTTTCTTCCCAAATATCAAGG - Intergenic
926974609 2:18501711-18501733 CAGAACATTCCCCCATATCCTGG - Intergenic
928943027 2:36746348-36746370 GAAACTATTCCAAAATATCAAGG - Intronic
928980775 2:37133377-37133399 CAGCATATTCCCAAATGAAATGG - Intronic
928999687 2:37334135-37334157 CTGATTATTCCCAAATATGGAGG + Intergenic
929581310 2:43083159-43083181 CAGATTTTTCTCAAATGTCAAGG + Intergenic
930466785 2:51763275-51763297 CATAAAAATCCCAACTATCAAGG + Intergenic
931527635 2:63174569-63174591 AAGAATATTTCAAAATGTCAAGG - Intronic
931706745 2:64952544-64952566 ATGAATATTCCCAAATATTAAGG + Intergenic
933919134 2:87027242-87027264 AAGAGAATTCCCAAATTTCAGGG + Intergenic
934003860 2:87742665-87742687 AAGAGAATTCCCAAATTTCAGGG - Intergenic
935140720 2:100350641-100350663 CAGGCTATTCCCAATTATCCAGG - Intergenic
935333987 2:101998042-101998064 CAGAAGAATCCAGAATATCAAGG + Intronic
935383899 2:102481160-102481182 CATAATTTTGCCAAATATCGTGG + Intronic
935434196 2:103010761-103010783 GAGAATCTTCCCTAATATCTCGG - Intergenic
935474978 2:103508177-103508199 CAGAATATTTTCTAATATCTTGG - Intergenic
935885038 2:107608553-107608575 AAGAATAATACCAAATATTAGGG + Intergenic
937009638 2:118551048-118551070 AAGAAGAGTTCCAAATATCAGGG + Intergenic
938137117 2:128768634-128768656 AAAAATATTGCTAAATATCAAGG + Intergenic
938571069 2:132562326-132562348 AAGAATTTTCCCAAATATGATGG - Intronic
939800606 2:146702116-146702138 AATAAAATTCCCAAATGTCAAGG + Intergenic
939829572 2:147055885-147055907 CTGAATATTCCAAAATATCATGG - Intergenic
939850496 2:147298462-147298484 GAGAATAATCCCAGCTATCATGG - Intergenic
941050422 2:160726411-160726433 GAAACTATTCCAAAATATCAAGG + Intergenic
944283799 2:197924867-197924889 TAGATTATTCTCAAATATTATGG - Intronic
944295357 2:198055257-198055279 CATAATATTCACAAACCTCAAGG + Intronic
945260518 2:207838742-207838764 CAGATTTTTCCTAAATACCAAGG - Intronic
946025940 2:216671755-216671777 CTGAATATTCCCAGTTCTCAGGG + Intergenic
947039089 2:225894684-225894706 CAAAATAATCCCAAATAAAATGG + Intergenic
948003500 2:234588520-234588542 CAGAATATTTGCAAAACTCATGG + Intergenic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1171814004 20:29767336-29767358 CAGCATATTCACAACCATCAAGG - Intergenic
1177394424 21:20513837-20513859 CAGATTTTTCCCAAATATTAGGG + Intergenic
1178942205 21:36915455-36915477 CTGAATGTTCCCAAGTGTCATGG - Intronic
1179140210 21:38718549-38718571 CAGAATTATCCCAAATATTGTGG - Intergenic
1179193722 21:39145066-39145088 CAGAGTATCCTCAAATTTCAGGG - Intergenic
1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG + Exonic
950955208 3:17045845-17045867 CAGAATTTTTCTAAATGTCACGG - Intronic
951907095 3:27716178-27716200 CAGAATATTCCCAAATATCATGG + Intronic
953852783 3:46478753-46478775 CAGAATATTTCCAAATATCCTGG - Intronic
954086465 3:48247892-48247914 CAGAGTATTCTAAAATATAATGG + Intronic
954486443 3:50857214-50857236 AAAACTATTCCAAAATATCAAGG - Intronic
956080927 3:65555262-65555284 GACAATAATCCCTAATATCATGG + Intronic
956408674 3:68955609-68955631 CAGCCTATTGTCAAATATCAAGG + Intergenic
957162888 3:76633349-76633371 CAATACATTCACAAATATCAGGG - Intronic
957184092 3:76919367-76919389 CAAATTATTCCAAAATATAAGGG + Intronic
957882967 3:86245986-86246008 CAGACTAGTCCTATATATCAAGG + Intergenic
958003308 3:87779100-87779122 CAGGATTTTCCCTAAGATCAGGG + Intergenic
958096824 3:88956493-88956515 CAGAGAATTTCAAAATATCAAGG - Intergenic
959878809 3:111418899-111418921 GAGAATTTGCACAAATATCATGG - Intronic
962298654 3:134216858-134216880 CAGAACATTCCCCAATATCCAGG - Intronic
963438568 3:145306204-145306226 CAGAATAATCCCACATCTTAAGG + Intergenic
964504649 3:157385712-157385734 AAGAATATTCACAATTATCAAGG - Intronic
965181263 3:165406236-165406258 AAGAAAATTCCCAAAGGTCAAGG + Intergenic
965518877 3:169652890-169652912 CTGAATATTCCCAAATCCCTAGG + Intronic
965579870 3:170256226-170256248 CAAAATATTCCAAAATATGGAGG - Intronic
966348547 3:179004908-179004930 CAGAACATTCCCACATCTGATGG + Intergenic
970875603 4:20866106-20866128 AAAACTATTCCAAAATATCAAGG + Intronic
973129068 4:46627138-46627160 TAGAATATAATCAAATATCATGG - Intergenic
975612956 4:76219455-76219477 CAGCATATTGTGAAATATCAAGG + Intronic
975950946 4:79770502-79770524 CTGAATCTTCCCAAATCTCTAGG + Intergenic
977224542 4:94379628-94379650 CATAATATTCAAAAGTATCAAGG + Intergenic
977690156 4:99897243-99897265 CAGAATATTCACAAATCTATTGG + Exonic
979044372 4:115843268-115843290 CACAATTTTCTGAAATATCAAGG + Intergenic
979317723 4:119284452-119284474 AACAATGTTCCCAAATATAATGG - Intronic
979867350 4:125773212-125773234 CTGAATACTCTCAAATATAATGG - Intergenic
980413559 4:132455884-132455906 CAGATTATTAACAAAAATCATGG + Intergenic
980743553 4:136984535-136984557 CATAATATTTTCAAATATTAGGG + Intergenic
981173155 4:141648172-141648194 CAGCATATTTCCTATTATCAGGG + Intronic
981280249 4:142949097-142949119 CAGAATATACCAAAATCTCTGGG + Intergenic
982453981 4:155585977-155585999 CAAATTCTTCCAAAATATCATGG + Intergenic
982699257 4:158640843-158640865 GAAAATATCCCCATATATCAAGG + Intronic
984344693 4:178507584-178507606 CAAAATCTTCCAAAATATAAAGG + Intergenic
984481146 4:180303297-180303319 AAACCTATTCCCAAATATCAAGG - Intergenic
984907020 4:184637893-184637915 CAGAATATTCCAAAAAGACACGG + Intronic
985060889 4:186077332-186077354 CAGAATATCCCCTAAGAACATGG + Intronic
986465459 5:8016927-8016949 CAAAATATTTCCAAATATTTGGG + Intergenic
986979302 5:13428532-13428554 CAGGATATTCCCGCATTTCAAGG + Intergenic
987368847 5:17174802-17174824 CAAAATATTCACAATTATAATGG + Intronic
987691715 5:21275460-21275482 AAGAAAATAACCAAATATCAGGG - Intergenic
987714223 5:21545831-21545853 CAGTATAGTCCCAGTTATCAGGG - Intergenic
988052245 5:26045787-26045809 GAAACTATTCCCAAAAATCAAGG + Intergenic
988195516 5:28000396-28000418 GAAACTATTCCCAAAAATCAAGG - Intergenic
989510254 5:42278429-42278451 CAGGTTATTCTCAAACATCAGGG + Intergenic
989576243 5:42991337-42991359 AGAAATATCCCCAAATATCAAGG + Intergenic
989585020 5:43067704-43067726 ACGATTATTCCCATATATCAAGG - Intronic
990825030 5:59889576-59889598 CAGAATATTTTATAATATCAAGG + Intronic
991156196 5:63439318-63439340 GAGAAAATTACCAAATACCAAGG - Intergenic
991748664 5:69774678-69774700 AAGAAAATAACCAAATATCAGGG + Intergenic
991800243 5:70354503-70354525 AAGAAAATAACCAAATATCAGGG + Intergenic
991828357 5:70655538-70655560 AAGAAAATAACCAAATATCAGGG - Intergenic
991892600 5:71353930-71353952 AAGAAAATAACCAAATATCAGGG + Intergenic
992753079 5:79878998-79879020 CAGAGCATTCCCAAATCCCATGG - Intergenic
993021187 5:82593360-82593382 TATAATATTCCCAAATATAGTGG + Intergenic
993500718 5:88663229-88663251 CAGAATATTCTTAAATATTTTGG + Intergenic
994264625 5:97700223-97700245 CAGCATATTCCCAGATGTTATGG + Intergenic
994357614 5:98811675-98811697 GACAATATGCCCAAATTTCAGGG + Intergenic
994816853 5:104596051-104596073 CAGCATATTCCCAAATGAGATGG - Intergenic
995616311 5:113968182-113968204 AAGAATATTCCGAAATATTCAGG - Intergenic
997789585 5:136745708-136745730 CAAACTATTCCCAAAAATAAAGG + Intergenic
1000500189 5:162038490-162038512 TAGAATATTAGCATATATCATGG + Intergenic
1003718462 6:8673787-8673809 CAGAATATTTCAAAACAACATGG + Intergenic
1005207682 6:23422984-23423006 GAAAATATTCCAAAAAATCAAGG + Intergenic
1005760710 6:28965110-28965132 CAGAAGAATCCCAATTATCCAGG + Intergenic
1006533825 6:34681327-34681349 CAGTTTATTCCCAAATATAGAGG - Intronic
1007954831 6:45907565-45907587 TAAACTATTCCAAAATATCAAGG - Intronic
1008733707 6:54515736-54515758 CAGATTATTCTCAGACATCAGGG + Intergenic
1009002504 6:57736248-57736270 CAGTATAGTCCCAGTTATCAGGG + Intergenic
1009042746 6:58199700-58199722 GAGAATATTCCCAAATAGTAAGG + Intergenic
1010647534 6:78409462-78409484 TAGAATATTCCCTAATATTTGGG + Intergenic
1010690924 6:78910361-78910383 TTGAATATTCCAAAATATCCTGG - Intronic
1011360888 6:86523418-86523440 GAAACTATTCCAAAATATCAAGG - Intergenic
1012385651 6:98678975-98678997 CTCACTAATCCCAAATATCAGGG + Intergenic
1013988566 6:116226117-116226139 CAGATTATTTCTTAATATCAAGG - Intronic
1015924254 6:138293425-138293447 AAGAATGTTCCCCAATATGATGG - Intronic
1018500073 6:164398242-164398264 CAGAATATTAGGAAATATCTTGG + Intergenic
1020402251 7:7792540-7792562 CAAATTATTCCATAATATCATGG - Intronic
1021663550 7:22947778-22947800 AAGCATTTTCCCAAATATCATGG - Intronic
1021800262 7:24298333-24298355 CAGATAATTCCCAAATAGTAAGG - Intergenic
1021826478 7:24557703-24557725 CAGAAGATTTCCAAATATTTTGG - Intergenic
1021842861 7:24735003-24735025 AAGCAAATTCCCAAAAATCAAGG + Intronic
1022280113 7:28899647-28899669 TAGAATTTTCCCTAATTTCATGG - Intergenic
1022562346 7:31362796-31362818 GAGAATATGCTCAAATATCTGGG - Intergenic
1022997952 7:35777691-35777713 AAGAATATATGCAAATATCAGGG - Intergenic
1023306735 7:38838269-38838291 CAGGATATTCCCAAACATAGAGG + Intronic
1023524077 7:41080632-41080654 CATAATAATCCCAAATAATAAGG + Intergenic
1023530289 7:41146346-41146368 CAGAAGATTCACATATATTAAGG + Intergenic
1024386413 7:48756952-48756974 AAGAATATTTCCAAATATCTGGG - Intergenic
1024662426 7:51511114-51511136 CAGGATATTCACAACTATGATGG - Intergenic
1027689939 7:81332042-81332064 GAGAATATTCCCAATAATCTGGG - Intergenic
1028117643 7:87018425-87018447 CAAAATATTCCTACATGTCAGGG - Intronic
1029051348 7:97692160-97692182 CAAAATATTCCCAAACAATAGGG + Intergenic
1029969699 7:104777196-104777218 CATAATATTTCCAAATTTCAAGG - Intronic
1029982793 7:104895005-104895027 CTGCATATTCCCAAATATGCAGG + Intronic
1030352350 7:108504054-108504076 AAGAATATGCCCAAAAATCAGGG + Intronic
1030850864 7:114485687-114485709 CAGAATAATCCCAAAAATGTAGG - Intronic
1031318601 7:120290627-120290649 GAGAATATTTCCAAATCTAATGG + Intronic
1031465714 7:122108272-122108294 CAAACTATTCCAGAATATCAAGG + Intronic
1032258417 7:130315196-130315218 TAGCATATTCCCAAATAAAATGG + Intronic
1032896141 7:136252937-136252959 CAGAACAATCACAAATAACATGG - Intergenic
1034530802 7:151695298-151695320 CAGAAGAGTCCCAAAGATCAAGG - Intronic
1035037481 7:155904569-155904591 CAAAATTATCCCAAATACCATGG - Intergenic
1037063992 8:14553225-14553247 CAAAATATTCCCAAATGAGAGGG + Intronic
1037069412 8:14624936-14624958 AAGAATAATTCTAAATATCAAGG - Intronic
1039529012 8:38243076-38243098 CAGAATATACCCAAATCACAGGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043621196 8:82194392-82194414 CAGAATATTCCCAAATATTCTGG - Intergenic
1043663478 8:82777119-82777141 CAGAATACTCCTAAATACCAAGG + Intergenic
1044531416 8:93311722-93311744 CAGAATTTTCCCACACATTAGGG - Intergenic
1044748136 8:95390916-95390938 CAGAATTTTCCCACAAACCATGG - Intergenic
1045602097 8:103729116-103729138 CAAAGTATTCCCAAAAATAAAGG - Intronic
1046815839 8:118582726-118582748 CAGAAAAGTCACAAAAATCATGG + Intronic
1047988779 8:130264047-130264069 CAGAGGATTCCTAAATATGATGG + Intronic
1048538389 8:135319093-135319115 CAGGAGATTCCAAATTATCAGGG - Intergenic
1048865559 8:138758837-138758859 CAGCAGTTTCCCAAATATGAAGG + Intronic
1050224664 9:3439023-3439045 TAGAATATCCCCAAATATTTTGG + Intronic
1050626953 9:7514724-7514746 GAAAATATACCAAAATATCATGG + Intergenic
1051279657 9:15429245-15429267 CTGAATGTTCTCAAATGTCAAGG + Intronic
1051719897 9:20025967-20025989 CATAATATTCCTTACTATCATGG - Intergenic
1051765548 9:20518817-20518839 AAGAATTTTCAAAAATATCAAGG + Intronic
1051779656 9:20675502-20675524 CACAATATTCCCAACTCACAGGG + Intronic
1053583506 9:39431963-39431985 CTGAATATTTACAAATTTCATGG - Intergenic
1053847700 9:42256819-42256841 CTGAATATTTACAAATTTCATGG - Intergenic
1054105086 9:60990706-60990728 CTGAATATTTACAAATTTCATGG - Intergenic
1055235684 9:74119821-74119843 TGGAATATTACCAAATATTATGG - Intergenic
1055276037 9:74617540-74617562 CAGCATAATCCTAAATATTATGG - Intronic
1058188602 9:101886176-101886198 CAGGATAATCTCAAATATCTGGG + Intergenic
1059966008 9:119614528-119614550 CAGAGAATTCTCAAATATTAAGG - Intergenic
1185917824 X:4055678-4055700 CAAAATATTCCGATAAATCAAGG + Intergenic
1186373718 X:8974515-8974537 CAAATTATTCACAATTATCAAGG + Intergenic
1186646185 X:11509578-11509600 CAGAATGTAGCAAAATATCAGGG - Intronic
1187249941 X:17588151-17588173 CATCATATTCCAAAATAACACGG + Intronic
1187637399 X:21245321-21245343 GAAACTATTCCAAAATATCAAGG - Intergenic
1189122739 X:38412488-38412510 TAGAACATTTCCAAATTTCATGG + Intronic
1189614329 X:42768318-42768340 CAGCATATTCCCAAATGAAATGG - Intergenic
1190462429 X:50691777-50691799 CTGAATATTCACAAATTTTAGGG + Intronic
1191189715 X:57653775-57653797 TAAAATGTTCACAAATATCAAGG + Intergenic
1192438797 X:71159701-71159723 AAGAAAATTCCCAAGCATCAGGG - Intronic
1192573905 X:72227603-72227625 CAGCATATTCCCAAATGAAATGG - Intronic
1192775613 X:74241243-74241265 CAGTGCATTCCCAAATATCAGGG - Intergenic
1194898279 X:99472367-99472389 GAAACTATTCCCAAAAATCAAGG + Intergenic
1195093286 X:101484010-101484032 CAGAATAATCCCAAAACTCAGGG - Intronic
1195108076 X:101619401-101619423 CAGAATAATCCCAAAACTCAGGG + Intergenic
1195663979 X:107411549-107411571 GAAACTATTCCAAAATATCAAGG - Intergenic
1195997148 X:110742588-110742610 CAAATTATTTCCAAGTATCAGGG + Intronic
1196963679 X:121031637-121031659 GAGAATATTCACAAATAAAATGG + Intergenic
1196980600 X:121209342-121209364 CAGCATATTCCCAAATATGGTGG - Intergenic
1197255539 X:124259083-124259105 CAGAATAATCTCAATGATCAGGG - Intronic
1199395233 X:147329718-147329740 CAGAAAACCCCAAAATATCATGG + Intergenic
1200326079 X:155240996-155241018 CAGAATACACAGAAATATCAAGG - Intergenic
1200894764 Y:8363384-8363406 CATAATATTCCCCATTGTCAGGG + Intergenic
1201207851 Y:11649796-11649818 CAGAATGGACCCAAATATAATGG + Intergenic
1201208095 Y:11651944-11651966 CAGAATAGACACAAATATAATGG + Intergenic
1201934610 Y:19394994-19395016 TAACATAATCCCAAATATCATGG + Intergenic
1201966223 Y:19739451-19739473 ATGAATTTTCCCCAATATCAAGG + Intronic