ID: 951907945

View in Genome Browser
Species Human (GRCh38)
Location 3:27722074-27722096
Sequence GAGCCCGCAGCCGCCAGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951907945_951907953 21 Left 951907945 3:27722074-27722096 CCTGCGCTGGCGGCTGCGGGCTC 0: 1
1: 0
2: 1
3: 24
4: 228
Right 951907953 3:27722118-27722140 GAGACTGCCGGAAAACTTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 97
951907945_951907946 -3 Left 951907945 3:27722074-27722096 CCTGCGCTGGCGGCTGCGGGCTC 0: 1
1: 0
2: 1
3: 24
4: 228
Right 951907946 3:27722094-27722116 CTCCCCGCTCACCGCCTCGCAGG 0: 1
1: 0
2: 2
3: 12
4: 178
951907945_951907951 9 Left 951907945 3:27722074-27722096 CCTGCGCTGGCGGCTGCGGGCTC 0: 1
1: 0
2: 1
3: 24
4: 228
Right 951907951 3:27722106-27722128 CGCCTCGCAGGAGAGACTGCCGG 0: 1
1: 0
2: 1
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951907945 Original CRISPR GAGCCCGCAGCCGCCAGCGC AGG (reversed) Exonic