ID: 951908086

View in Genome Browser
Species Human (GRCh38)
Location 3:27722774-27722796
Sequence CAGCCCGGAGACCCTCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951908081_951908086 1 Left 951908081 3:27722750-27722772 CCAGGGAGGGGCTTCCCGGCCTC 0: 1
1: 0
2: 8
3: 35
4: 256
Right 951908086 3:27722774-27722796 CAGCCCGGAGACCCTCCTATTGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951908086 Original CRISPR CAGCCCGGAGACCCTCCTAT TGG Intergenic
900115130 1:1025068-1025090 CAGCCAGGAGTCCCTCCTGGGGG - Intronic
900192334 1:1356750-1356772 CAGCCCCGAGACCCCCCACTTGG + Intronic
903082734 1:20824540-20824562 CAGCCCACAAATCCTCCTATAGG + Intronic
911070595 1:93829102-93829124 CAGACCGGAGACCCTCTTTTGGG - Intronic
915857498 1:159405333-159405355 CAGTCCAGGGAGCCTCCTATGGG - Intergenic
917693728 1:177495988-177496010 CAGCCCGAATACCCTCCCCTTGG + Intergenic
1066247278 10:33595648-33595670 CTGCCTGGAGTCCCACCTATGGG + Intergenic
1070782571 10:79146200-79146222 CAGAGCGGAGACCCTGCTCTAGG - Intronic
1070890810 10:79941304-79941326 CATCCCAGAGCCCCTCCTCTGGG + Intronic
1072809322 10:98446867-98446889 CAGCCCGGAGGCCCACGTACCGG + Exonic
1075257852 10:120939533-120939555 CAGCCAGGAGAGCATGCTATTGG - Intergenic
1076828253 10:132981325-132981347 CACCCCTGAGCCCCTCCTCTGGG - Intergenic
1077417770 11:2432829-2432851 CAGCCCGGAGCCCCTCAGACAGG + Intergenic
1077480166 11:2810872-2810894 CAGCCGGGAGTCCCACCTGTAGG + Intronic
1080270378 11:30445184-30445206 CAGCCCGGGGAGTCTCCTAGTGG - Intronic
1083633868 11:64109659-64109681 CAGCCTGGAGGGCCTCCCATGGG + Intronic
1084146651 11:67268541-67268563 CAGCCTCGAGACCCTCCTGCAGG + Intronic
1093036759 12:14339219-14339241 CAGCTTGGAGAAACTCCTATAGG + Intergenic
1100599302 12:96099186-96099208 CAGCCCTGAGACCCCTCTTTTGG - Intergenic
1102454819 12:113064995-113065017 CAGGCCTGAGACCCTCCTCCAGG - Intronic
1112228467 13:97564522-97564544 CAGCCTGAAAACCCTTCTATGGG - Intergenic
1119506496 14:75177213-75177235 CAGCCCAAATACCCTGCTATGGG - Intergenic
1121044396 14:90777435-90777457 CAGCTCCCAGAACCTCCTATGGG - Intronic
1126849944 15:52790647-52790669 CAGCCCGGGGACGCTCGTGTCGG + Intronic
1128724009 15:69974572-69974594 CATCCCTGAGTCCCTCCCATAGG - Intergenic
1133129395 16:3667183-3667205 CAGCCTGGACACCCTTCTCTGGG - Intronic
1139167180 16:64580922-64580944 CAAACCGGAGACCCTCTTTTGGG + Intergenic
1141612682 16:85191898-85191920 CACCCTGGAGACCCTGCTAATGG - Intergenic
1141945929 16:87310362-87310384 CAGCCTGGCGACCCTCCAAGGGG + Intronic
1142919796 17:3174433-3174455 CAGATCGGAGACCATCCTTTAGG - Intergenic
1144515920 17:15917580-15917602 TAGCCCGGAGCCCCGCCTAGGGG - Intergenic
1150127140 17:62644741-62644763 CAGCCCGCAGATCCTCATTTGGG + Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152540402 17:80971761-80971783 CAGCCGGGAGAGCCTCCAAGGGG - Intergenic
1152895572 17:82909151-82909173 CAGCCAGGAGAGCCGCCTAGGGG - Intronic
1153045392 18:851221-851243 CAGCCCAGACAACCTTCTATGGG + Intergenic
1160825257 19:1077212-1077234 GAGCCCGGAGACGCTCCCGTGGG + Intronic
1160970801 19:1766968-1766990 GAGCCCGGGGCCCCTCCTCTGGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162450223 19:10749893-10749915 CTGCCAGGAAACCCTCCCATAGG - Intronic
1163442363 19:17328473-17328495 AAGCCCGGAGGCCCTCCTGGAGG - Exonic
1164395419 19:27859428-27859450 CAGCCAAGAGATCCTCCTCTTGG - Intergenic
1166139344 19:40797668-40797690 CACACCGGAGGCCCACCTATAGG - Intronic
929413955 2:41728494-41728516 CAGCCAGGAGCTTCTCCTATAGG - Intergenic
937268065 2:120629755-120629777 CAGCCAGGAGCCCCTCCTGGAGG - Intergenic
939236306 2:139498427-139498449 CAGCCTAAAGACCCTCCAATTGG - Intergenic
1172444090 20:34984308-34984330 CAGCCAGGAGGCCTTCCTAGAGG + Intronic
1179128683 21:38614800-38614822 CAGCAGGGAGTCCCTCCTTTGGG + Intronic
1180898991 22:19357396-19357418 CAGCCAGGAGACTGTCCTGTGGG - Intronic
951908086 3:27722774-27722796 CAGCCCGGAGACCCTCCTATTGG + Intergenic
960153502 3:114274861-114274883 CAGCCCTGAGACTCTCCCTTCGG + Intergenic
962754988 3:138459965-138459987 CATCCTGGAGCCCCTCCTAGTGG + Exonic
966421972 3:179742846-179742868 AAGCCCAGAGACCCTTCTAATGG - Intronic
967996917 3:195173806-195173828 CACCAGGGAGTCCCTCCTATGGG + Intronic
969100452 4:4764282-4764304 CATCCCGGAGACCCCACTCTGGG - Intergenic
979937362 4:126715067-126715089 CAAACCGGAGACCCTCTTTTGGG - Intergenic
980095265 4:128483446-128483468 GAGGCTGAAGACCCTCCTATAGG - Intergenic
985025741 4:185737573-185737595 GAGCTCGGAGACCCTGCTTTCGG + Intronic
985670836 5:1205853-1205875 CAGCCCCCACACCCTCCCATAGG + Intronic
992005669 5:72475192-72475214 CAGCCTGAAGACCTTCCTGTAGG + Intronic
996646816 5:125827076-125827098 CAGCCCTGAGACCCTTCATTAGG - Intergenic
996665662 5:126057217-126057239 CAAACCGGAGACCCTCTTTTGGG - Intergenic
1001775948 5:174329175-174329197 CTGCGAGGAGACCCTCCTCTGGG + Intergenic
1005175845 6:23043728-23043750 CAGCCTGAAGATGCTCCTATTGG + Intergenic
1015961028 6:138649825-138649847 CAGCCCAGAGCCCATCCTGTAGG - Intronic
1019188880 6:170238563-170238585 CAGCCCGGGGTCCCTCCTCAAGG + Intergenic
1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG + Intronic
1024042085 7:45563716-45563738 CAGCCAGGAAACCCACTTATGGG - Intergenic
1024628346 7:51227526-51227548 CAGCCAGGAGCACCTGCTATGGG + Intronic
1035235940 7:157497786-157497808 CAGGCCTGAAACCCTCCCATTGG + Intergenic
1039973231 8:42338296-42338318 CAGCCCAGGGGCCTTCCTATGGG - Intergenic
1040128191 8:43763094-43763116 CAGCCTGGAAACCCTCTTTTTGG + Intergenic
1044503458 8:92990470-92990492 CAGACCGGAGCTCTTCCTATTGG - Intronic
1048339762 8:133529542-133529564 GGGCCCGGAGCCCCTCCTCTGGG - Intronic
1049213408 8:141396957-141396979 CAGCCCGGCTACCCTCCCACAGG - Intronic
1053557236 9:39149917-39149939 CAGCCCTGAAACCCTCCCAGGGG + Exonic
1053821344 9:41970185-41970207 CAGCCCTGAAACCCTCCCAGGGG + Exonic
1054090221 9:60838337-60838359 CAGCCCTGAAACCCTCCCAGGGG + Intergenic
1054111632 9:61113894-61113916 CAGCCCTGAAACCCTCCCAGGGG + Intergenic
1054609225 9:67217231-67217253 CAGCCCTGAAACCCTCCCAGGGG - Intergenic
1056954461 9:91071285-91071307 CAGGCCTGAGGCCCTCTTATGGG + Intergenic
1057180248 9:93025953-93025975 CAGCCTGGCCACCCTCCTGTTGG + Intronic
1057267583 9:93629548-93629570 CAGCTCAGAGCCCCTCCTGTGGG - Intronic
1059320446 9:113464393-113464415 CAGCCCTGGGACCCTCCTAAGGG - Intronic
1061153138 9:128840657-128840679 CAGCTCTGAGACCAGCCTATTGG + Intronic
1191235003 X:58127200-58127222 CAGCCAGGAGTCTCTCCCATTGG - Intergenic
1191246838 X:58234729-58234751 CAGCCAGGAGTCTCTCCCATTGG - Intergenic