ID: 951909206

View in Genome Browser
Species Human (GRCh38)
Location 3:27731477-27731499
Sequence ATCTGACCTAAGGCAGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909206_951909211 -3 Left 951909206 3:27731477-27731499 CCCAGTGCTGCCTTAGGTCAGAT No data
Right 951909211 3:27731497-27731519 GATCAAAGCGGAGGACCTAGAGG No data
951909206_951909212 -2 Left 951909206 3:27731477-27731499 CCCAGTGCTGCCTTAGGTCAGAT No data
Right 951909212 3:27731498-27731520 ATCAAAGCGGAGGACCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909206 Original CRISPR ATCTGACCTAAGGCAGCACT GGG (reversed) Intergenic
No off target data available for this crispr