ID: 951909252

View in Genome Browser
Species Human (GRCh38)
Location 3:27731761-27731783
Sequence CAATGTCTGACACACATACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909252_951909256 -8 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909256 3:27731776-27731798 AGACATTGCACGAGGTGCTGGGG No data
951909252_951909255 -9 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909255 3:27731775-27731797 CAGACATTGCACGAGGTGCTGGG No data
951909252_951909254 -10 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909254 3:27731774-27731796 TCAGACATTGCACGAGGTGCTGG No data
951909252_951909259 19 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909259 3:27731803-27731825 AAAGTGGATGATGTTGGATCCGG No data
951909252_951909257 3 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909257 3:27731787-27731809 GAGGTGCTGGGGTACAAAAGTGG No data
951909252_951909258 13 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909258 3:27731797-27731819 GGTACAAAAGTGGATGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909252 Original CRISPR CAATGTCTGACACACATACT AGG (reversed) Intergenic
No off target data available for this crispr