ID: 951909254

View in Genome Browser
Species Human (GRCh38)
Location 3:27731774-27731796
Sequence TCAGACATTGCACGAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909252_951909254 -10 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909254 3:27731774-27731796 TCAGACATTGCACGAGGTGCTGG No data
951909251_951909254 16 Left 951909251 3:27731735-27731757 CCACAATATTAGAAAACACTTGT No data
Right 951909254 3:27731774-27731796 TCAGACATTGCACGAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909254 Original CRISPR TCAGACATTGCACGAGGTGC TGG Intergenic