ID: 951909255

View in Genome Browser
Species Human (GRCh38)
Location 3:27731775-27731797
Sequence CAGACATTGCACGAGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909251_951909255 17 Left 951909251 3:27731735-27731757 CCACAATATTAGAAAACACTTGT No data
Right 951909255 3:27731775-27731797 CAGACATTGCACGAGGTGCTGGG No data
951909252_951909255 -9 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909255 3:27731775-27731797 CAGACATTGCACGAGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909255 Original CRISPR CAGACATTGCACGAGGTGCT GGG Intergenic