ID: 951909256 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:27731776-27731798 |
Sequence | AGACATTGCACGAGGTGCTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
951909251_951909256 | 18 | Left | 951909251 | 3:27731735-27731757 | CCACAATATTAGAAAACACTTGT | No data | ||
Right | 951909256 | 3:27731776-27731798 | AGACATTGCACGAGGTGCTGGGG | No data | ||||
951909252_951909256 | -8 | Left | 951909252 | 3:27731761-27731783 | CCTAGTATGTGTGTCAGACATTG | No data | ||
Right | 951909256 | 3:27731776-27731798 | AGACATTGCACGAGGTGCTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
951909256 | Original CRISPR | AGACATTGCACGAGGTGCTG GGG | Intergenic | ||