ID: 951909256

View in Genome Browser
Species Human (GRCh38)
Location 3:27731776-27731798
Sequence AGACATTGCACGAGGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909251_951909256 18 Left 951909251 3:27731735-27731757 CCACAATATTAGAAAACACTTGT No data
Right 951909256 3:27731776-27731798 AGACATTGCACGAGGTGCTGGGG No data
951909252_951909256 -8 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909256 3:27731776-27731798 AGACATTGCACGAGGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909256 Original CRISPR AGACATTGCACGAGGTGCTG GGG Intergenic