ID: 951909258

View in Genome Browser
Species Human (GRCh38)
Location 3:27731797-27731819
Sequence GGTACAAAAGTGGATGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909252_951909258 13 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909258 3:27731797-27731819 GGTACAAAAGTGGATGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909258 Original CRISPR GGTACAAAAGTGGATGATGT TGG Intergenic