ID: 951909259 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:27731803-27731825 |
| Sequence | AAAGTGGATGATGTTGGATC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 951909252_951909259 | 19 | Left | 951909252 | 3:27731761-27731783 | CCTAGTATGTGTGTCAGACATTG | No data | ||
| Right | 951909259 | 3:27731803-27731825 | AAAGTGGATGATGTTGGATCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 951909259 | Original CRISPR | AAAGTGGATGATGTTGGATC CGG | Intergenic | ||