ID: 951909259

View in Genome Browser
Species Human (GRCh38)
Location 3:27731803-27731825
Sequence AAAGTGGATGATGTTGGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951909252_951909259 19 Left 951909252 3:27731761-27731783 CCTAGTATGTGTGTCAGACATTG No data
Right 951909259 3:27731803-27731825 AAAGTGGATGATGTTGGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951909259 Original CRISPR AAAGTGGATGATGTTGGATC CGG Intergenic