ID: 951910607

View in Genome Browser
Species Human (GRCh38)
Location 3:27746719-27746741
Sequence ACAACCTCTCAGGCCAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951910607_951910613 0 Left 951910607 3:27746719-27746741 CCCTATTTGGCCTGAGAGGTTGT No data
Right 951910613 3:27746742-27746764 AGATGGGGTCTCATAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951910607 Original CRISPR ACAACCTCTCAGGCCAAATA GGG (reversed) Intergenic
No off target data available for this crispr