ID: 951910794

View in Genome Browser
Species Human (GRCh38)
Location 3:27748412-27748434
Sequence CAGTGTTACCAGTGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951910794_951910796 -1 Left 951910794 3:27748412-27748434 CCCACAACACACTGGTAACACTG No data
Right 951910796 3:27748434-27748456 GTGCTACCAGAGATAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951910794 Original CRISPR CAGTGTTACCAGTGTGTTGT GGG (reversed) Intergenic
No off target data available for this crispr