ID: 951918494

View in Genome Browser
Species Human (GRCh38)
Location 3:27827111-27827133
Sequence TTGGTCCTGTAGCCAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951918494_951918500 25 Left 951918494 3:27827111-27827133 CCCCACACTGGCTACAGGACCAA No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951918494 Original CRISPR TTGGTCCTGTAGCCAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr