ID: 951918500

View in Genome Browser
Species Human (GRCh38)
Location 3:27827159-27827181
Sequence TCGCACATGCACACATCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951918499_951918500 -9 Left 951918499 3:27827145-27827167 CCAAAGTTGCATTCTCGCACATG No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data
951918496_951918500 23 Left 951918496 3:27827113-27827135 CCACACTGGCTACAGGACCAACC No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data
951918494_951918500 25 Left 951918494 3:27827111-27827133 CCCCACACTGGCTACAGGACCAA No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data
951918497_951918500 6 Left 951918497 3:27827130-27827152 CCAACCTGTATTTAGCCAAAGTT No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data
951918498_951918500 2 Left 951918498 3:27827134-27827156 CCTGTATTTAGCCAAAGTTGCAT No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data
951918495_951918500 24 Left 951918495 3:27827112-27827134 CCCACACTGGCTACAGGACCAAC No data
Right 951918500 3:27827159-27827181 TCGCACATGCACACATCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951918500 Original CRISPR TCGCACATGCACACATCAAC AGG Intergenic
No off target data available for this crispr