ID: 951924370

View in Genome Browser
Species Human (GRCh38)
Location 3:27891393-27891415
Sequence CATGTTTACCAGCTTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951924370_951924378 29 Left 951924370 3:27891393-27891415 CCCCTGGAAAGCTGGTAAACATG No data
Right 951924378 3:27891445-27891467 TGAGCCAATACTTGAGATGTGGG No data
951924370_951924377 28 Left 951924370 3:27891393-27891415 CCCCTGGAAAGCTGGTAAACATG No data
Right 951924377 3:27891444-27891466 TTGAGCCAATACTTGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951924370 Original CRISPR CATGTTTACCAGCTTTCCAG GGG (reversed) Intergenic
No off target data available for this crispr