ID: 951926731

View in Genome Browser
Species Human (GRCh38)
Location 3:27915998-27916020
Sequence TCCCAAAGACACTCCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951926728_951926731 -2 Left 951926728 3:27915977-27915999 CCCTCCTTAGGGACTTTAGTCTC No data
Right 951926731 3:27915998-27916020 TCCCAAAGACACTCCCATAAAGG No data
951926730_951926731 -6 Left 951926730 3:27915981-27916003 CCTTAGGGACTTTAGTCTCCCAA No data
Right 951926731 3:27915998-27916020 TCCCAAAGACACTCCCATAAAGG No data
951926729_951926731 -3 Left 951926729 3:27915978-27916000 CCTCCTTAGGGACTTTAGTCTCC No data
Right 951926731 3:27915998-27916020 TCCCAAAGACACTCCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951926731 Original CRISPR TCCCAAAGACACTCCCATAA AGG Intergenic
No off target data available for this crispr