ID: 951930903

View in Genome Browser
Species Human (GRCh38)
Location 3:27966189-27966211
Sequence CTCAAACAGAGATAGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951930901_951930903 16 Left 951930901 3:27966150-27966172 CCTAGTCTTGGTGGTTACTTTTC No data
Right 951930903 3:27966189-27966211 CTCAAACAGAGATAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951930903 Original CRISPR CTCAAACAGAGATAGATCAA TGG Intergenic
No off target data available for this crispr