ID: 951931759

View in Genome Browser
Species Human (GRCh38)
Location 3:27975284-27975306
Sequence ATATGCCAGCTGGCCACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951931755_951931759 19 Left 951931755 3:27975242-27975264 CCTTTGTCATATAAGCACAGAAA No data
Right 951931759 3:27975284-27975306 ATATGCCAGCTGGCCACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951931759 Original CRISPR ATATGCCAGCTGGCCACAAT AGG Intergenic
No off target data available for this crispr