ID: 951932325

View in Genome Browser
Species Human (GRCh38)
Location 3:27982180-27982202
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951932325_951932328 0 Left 951932325 3:27982180-27982202 CCTTCCTCACACTGATGCTCCTG No data
Right 951932328 3:27982203-27982225 CTTTTGCCATGTGAGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951932325 Original CRISPR CAGGAGCATCAGTGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr