ID: 951933187

View in Genome Browser
Species Human (GRCh38)
Location 3:27992941-27992963
Sequence TCCCTTAGAAGAAGGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951933174_951933187 24 Left 951933174 3:27992894-27992916 CCATGATCCATGACTCCTACTGA No data
Right 951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG No data
951933175_951933187 17 Left 951933175 3:27992901-27992923 CCATGACTCCTACTGACTGCCCC No data
Right 951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG No data
951933180_951933187 -2 Left 951933180 3:27992920-27992942 CCCCAGGAACAATGAGGGTGCTC No data
Right 951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG No data
951933181_951933187 -3 Left 951933181 3:27992921-27992943 CCCAGGAACAATGAGGGTGCTCC No data
Right 951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG No data
951933177_951933187 9 Left 951933177 3:27992909-27992931 CCTACTGACTGCCCCAGGAACAA No data
Right 951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG No data
951933182_951933187 -4 Left 951933182 3:27992922-27992944 CCAGGAACAATGAGGGTGCTCCC No data
Right 951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951933187 Original CRISPR TCCCTTAGAAGAAGGCATGG GGG Intergenic