ID: 951934653

View in Genome Browser
Species Human (GRCh38)
Location 3:28008539-28008561
Sequence CATTTTGCTGAGTCCTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951934653_951934657 29 Left 951934653 3:28008539-28008561 CCACATGAGGACTCAGCAAAATG No data
Right 951934657 3:28008591-28008613 TCATCAGACATCGAAGCTGCTGG No data
951934653_951934655 3 Left 951934653 3:28008539-28008561 CCACATGAGGACTCAGCAAAATG No data
Right 951934655 3:28008565-28008587 TCATCTATAAACCAGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951934653 Original CRISPR CATTTTGCTGAGTCCTCATG TGG (reversed) Intergenic
No off target data available for this crispr