ID: 951940217

View in Genome Browser
Species Human (GRCh38)
Location 3:28069477-28069499
Sequence GCATGTTTAACAAACCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951940217_951940224 23 Left 951940217 3:28069477-28069499 CCAGGGTGGTTTGTTAAACATGC No data
Right 951940224 3:28069523-28069545 GCTTCTGAGTCAGAATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951940217 Original CRISPR GCATGTTTAACAAACCACCC TGG (reversed) Intergenic
No off target data available for this crispr