ID: 951940224

View in Genome Browser
Species Human (GRCh38)
Location 3:28069523-28069545
Sequence GCTTCTGAGTCAGAATCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951940216_951940224 27 Left 951940216 3:28069473-28069495 CCGGCCAGGGTGGTTTGTTAAAC No data
Right 951940224 3:28069523-28069545 GCTTCTGAGTCAGAATCTGTAGG No data
951940219_951940224 -5 Left 951940219 3:28069505-28069527 CCAAGGCCCCTTGCCACAGCTTC No data
Right 951940224 3:28069523-28069545 GCTTCTGAGTCAGAATCTGTAGG No data
951940215_951940224 28 Left 951940215 3:28069472-28069494 CCCGGCCAGGGTGGTTTGTTAAA No data
Right 951940224 3:28069523-28069545 GCTTCTGAGTCAGAATCTGTAGG No data
951940217_951940224 23 Left 951940217 3:28069477-28069499 CCAGGGTGGTTTGTTAAACATGC No data
Right 951940224 3:28069523-28069545 GCTTCTGAGTCAGAATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951940224 Original CRISPR GCTTCTGAGTCAGAATCTGT AGG Intergenic
No off target data available for this crispr