ID: 951954902

View in Genome Browser
Species Human (GRCh38)
Location 3:28242970-28242992
Sequence ATTTGGTTCTTGAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951954902 Original CRISPR ATTTGGTTCTTGAGGGTAGA AGG Intronic
901847908 1:11996235-11996257 AATTGCTTCCTGCGGGTAGAGGG + Exonic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
907113914 1:51951864-51951886 GTTAGGTCCTTGAGGGCAGAGGG + Intronic
908663203 1:66460937-66460959 CTTTTGTTCCTTAGGGTAGAAGG + Intergenic
910888770 1:91995094-91995116 ACTTGGTTCTGGTGGGTTGAAGG + Intronic
911942287 1:104061909-104061931 ATTTGGTTCGGCAGAGTAGATGG + Intergenic
912236169 1:107853560-107853582 TTTTGGTTCTTGAGGGATGGGGG - Intronic
919238131 1:194873026-194873048 ATTTGGATATTCAAGGTAGATGG + Intergenic
919888975 1:201956111-201956133 AATTCTTTCTTGAGGGTAGAGGG + Intronic
920038700 1:203082429-203082451 ATTAGCTTCCTGAGGTTAGAAGG - Intergenic
921828776 1:219703499-219703521 ATTGGGATCCTAAGGGTAGACGG - Intronic
924121449 1:240803424-240803446 ATTTGATTCTTCTGGGTAGTTGG - Intronic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
1063489239 10:6447937-6447959 GTTTGGTTTTTGAGGGCAAAAGG + Intronic
1067278248 10:44852908-44852930 ACTTGGTTATTGAGGCTTGATGG - Intergenic
1069750127 10:70739894-70739916 TTTTGGTTCATGTGTGTAGAAGG - Intronic
1070032871 10:72693445-72693467 ATGTGTTTATTGAGGGTTGAAGG - Intronic
1070787066 10:79168076-79168098 AATTGGCTCCAGAGGGTAGAGGG - Intronic
1073469343 10:103713166-103713188 AGTTGGATCTTGAGGGTGGTTGG - Intronic
1078480280 11:11669309-11669331 ATTTTGTTCCTGGGGGTAGGAGG - Intergenic
1080982173 11:37421702-37421724 ATTTGGCTTTTGTGGGTTGAGGG + Intergenic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1086156608 11:83673531-83673553 ATGAGGTTGTTGATGGTAGAAGG + Intronic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1096275516 12:50204198-50204220 TCTTGGTTGTTGAGGGAAGAAGG - Intronic
1096499334 12:52055596-52055618 GTTTGGTTCTTGAGGGCTGGGGG + Intronic
1097348043 12:58517008-58517030 ATTAGATTCTGGAGGGTGGAAGG + Intergenic
1097657271 12:62381712-62381734 AGTTGGTTCTTGGGGATAGGGGG + Intronic
1098028379 12:66230030-66230052 TTTTGGCTCTTGATGGGAGATGG + Intronic
1098135619 12:67398667-67398689 ATTTAGTTCCTGAGGATAAAAGG - Intergenic
1098899248 12:76095944-76095966 GATTAGTTCTTGAAGGTAGAAGG + Intergenic
1103093538 12:118114884-118114906 AATCCATTCTTGAGGGTAGAGGG - Intronic
1103970147 12:124665571-124665593 ATCTGGGCCTTGAAGGTAGATGG + Intergenic
1104566694 12:129891300-129891322 AGTTGGCTCTTGAGGGGTGAGGG - Intronic
1104637535 12:130447514-130447536 AATGGGTTCTTGAGGGGCGATGG + Intronic
1104637547 12:130447566-130447588 AATGGGTTCTTGAGGGGCGATGG + Intronic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1109139541 13:58696959-58696981 AGTTGTTACTTGAGGGTTGAGGG + Intergenic
1110218024 13:73044752-73044774 TTTGGGAACTTGAGGGTAGAGGG + Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1112253870 13:97809694-97809716 ATTTTGGTTTTGAGGGTAGGTGG - Intergenic
1113162861 13:107402296-107402318 TTTTGGTTCTTCTGGGTAGTTGG - Intronic
1113742455 13:112720995-112721017 ATTTGGCTCTTGAAGTCAGAAGG + Intronic
1117945699 14:61017437-61017459 ATATGTTACTTGAGGGTAAAAGG + Intronic
1119993235 14:79223681-79223703 ATTTGGTTATTGAAGGGAGCAGG - Intronic
1120108141 14:80519829-80519851 ATTGAGTTCTTTAGTGTAGATGG - Intronic
1121509373 14:94501002-94501024 AAGTGGTTTTTGGGGGTAGAAGG - Intronic
1122625266 14:103082293-103082315 GTTGGGTTATTGATGGTAGATGG + Intergenic
1122625286 14:103082381-103082403 GTTGGGTTATTGAAGGTAGATGG + Intergenic
1122625295 14:103082425-103082447 GTTGGGTTATTGAAGGTAGACGG + Intergenic
1122625389 14:103082979-103083001 GTTGGGTTATTGAAGGTAGATGG + Intergenic
1122625398 14:103083023-103083045 GTTGGGTTATTGAAGGTAGATGG + Intergenic
1122625407 14:103083067-103083089 GTTGGGTTATTGAAGGTAGATGG + Intergenic
1122625416 14:103083111-103083133 GTTGGGTTATTGAAGGTAGATGG + Intergenic
1123503213 15:20911058-20911080 AATTGGTGGGTGAGGGTAGAAGG - Intergenic
1123560461 15:21484723-21484745 AATTGGTGGGTGAGGGTAGAAGG - Intergenic
1123596700 15:21922019-21922041 AATTGGTGGGTGAGGGTAGACGG - Intergenic
1126475489 15:49061618-49061640 ATCTGGGTCCTGCGGGTAGACGG + Intergenic
1128331896 15:66761495-66761517 TATTTGTTCTTGTGGGTAGAAGG - Intronic
1129162572 15:73754742-73754764 AATTGGTTTTGGAGGGTAGAAGG + Intergenic
1129939207 15:79479141-79479163 TTGTGGTTTTTGAGGGTGGAAGG + Intergenic
1130528246 15:84725325-84725347 CTTTGGTTGTTGGGGGTGGAGGG - Intergenic
1130690176 15:86075534-86075556 ATTTCTTTCCTGAGAGTAGAAGG - Intergenic
1131714460 15:95093431-95093453 AGTTGGTGTTTGAGAGTAGAAGG + Intergenic
1131828812 15:96341527-96341549 ATTTGGTTCTTGGAAGGAGAGGG - Intergenic
1132345127 15:101103442-101103464 GTTGGGTTCTGGAGGGTGGAGGG - Intergenic
1202968809 15_KI270727v1_random:211887-211909 AATTGGTGGGTGAGGGTAGAAGG - Intergenic
1134648871 16:15892551-15892573 ATTTCTTCCTTGAGGGTAGCAGG - Intergenic
1135801418 16:25500240-25500262 AATTGGCTCCTGAGGGTGGAAGG + Intergenic
1138284175 16:55795170-55795192 ATTTTGTTCTTTAGGGGTGAAGG - Intergenic
1138284827 16:55801817-55801839 ATTTTGTTCTTTAGGGGTGAAGG + Intergenic
1139204886 16:65018155-65018177 CTTGGGTTCTTGAGTGGAGAAGG - Intronic
1140685795 16:77433396-77433418 ATTCGGTTCTTGATGGAAGAAGG + Intronic
1143230684 17:5351864-5351886 ATTTTGTTCTTGAGTGTAGATGG + Intronic
1145810644 17:27761981-27762003 TTTTGCTTCTTGAGGACAGAGGG + Intronic
1148391625 17:47276756-47276778 ATTTTGTTCTTGAGAGGAGCAGG + Intronic
1149818417 17:59749859-59749881 GTTTGCTTCTAGTGGGTAGACGG - Intronic
1151233738 17:72703298-72703320 AGTTGGAACTTGAGTGTAGAGGG - Intronic
1151824825 17:76518375-76518397 ATATGGTTCTGGAGGCTGGAAGG - Intergenic
1156937546 18:42728995-42729017 ATTAGCTTCTAGAAGGTAGAAGG + Intergenic
1165925152 19:39321639-39321661 TTAGGGTCCTTGAGGGTAGAAGG - Intergenic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1168579549 19:57543342-57543364 ATTTGCTCCTTGGGTGTAGAGGG - Intronic
925232807 2:2250789-2250811 TTTTAGTTCTTGTGGGTACATGG - Intronic
926950901 2:18242267-18242289 ATTTGCTCCTTGAGGGTTGTTGG - Intronic
928244667 2:29616840-29616862 ATTTGGCTCTTTAGGGCAAAAGG - Intronic
928873743 2:36012521-36012543 ATTAAGTTATAGAGGGTAGAAGG - Intergenic
929537379 2:42792313-42792335 TCTTGGTTCTTGGGGGAAGATGG - Intronic
930461076 2:51676970-51676992 ATTTGGTTCTTGAACGTACTTGG + Intergenic
930765584 2:55082015-55082037 ATTTGATTCTTTCAGGTAGATGG + Intronic
937513496 2:122626371-122626393 ATTTGGCTCTTGGTGGTAGGAGG + Intergenic
938644776 2:133319260-133319282 ATCTCATTTTTGAGGGTAGAGGG + Intronic
941615995 2:167720289-167720311 ATTTGGTCTTTGCTGGTAGAGGG + Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
947513853 2:230784096-230784118 ATTTGGGTGGTGATGGTAGACGG + Intronic
1169545907 20:6650434-6650456 AGTTGCTACTTGAGGGTGGAGGG + Intergenic
1169802742 20:9527679-9527701 ATTTGCTTCTTGTGGGTAACTGG - Intronic
1169895536 20:10501610-10501632 ACTTGGTTCTCGAGGGCAGCAGG + Intronic
1174194336 20:48762407-48762429 ATTTGTATCTAGAGGGTAGAGGG - Intronic
1175642711 20:60644251-60644273 ATTTGATTCTTGATTGTAAAAGG - Intergenic
1176051912 20:63124442-63124464 ATTTGGTGCGAGAGGGTTGAGGG - Intergenic
1177523300 21:22259453-22259475 TCTTGGTTCTTAAGGGTGGATGG + Intergenic
1177822350 21:26045170-26045192 ATTTTATTCCTGAGGGAAGATGG + Intronic
1178709484 21:34902258-34902280 AATTGGTTCTTGAAGGGAGGAGG + Intronic
1180590348 22:16931973-16931995 TTATGGTTCCAGAGGGTAGAAGG + Intergenic
1182811047 22:33116786-33116808 AGTTGGTTGTTGAGGGGAGGTGG + Intergenic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184549383 22:45196421-45196443 ATTTGGATTCTGAGGGTAGTCGG - Exonic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
952627786 3:35427839-35427861 ATTTGGCTTTTGATGGTAGAGGG - Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952815217 3:37441810-37441832 AATTGGTGCTTGAGGTTAGCAGG + Intergenic
952945548 3:38476150-38476172 ATGTGGTTCCTGCGGGTAGTGGG + Intronic
954527243 3:51283093-51283115 ATTTGGTGTCTGTGGGTAGAGGG - Intronic
955508149 3:59652566-59652588 ATCTGTTTCTTGAGGGTCCAGGG + Intergenic
956455819 3:69419737-69419759 ATTTGGTTCTTGACTTTACAAGG - Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957199468 3:77113413-77113435 ATTTGGTTCTTGGGGATTGATGG + Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
960139660 3:114139842-114139864 GTCAGGTCCTTGAGGGTAGAAGG + Intronic
961854873 3:129860130-129860152 AGTTGATTCCTGAGGGTAGAGGG - Intronic
963730963 3:148971698-148971720 ATTTGTTTCCTGGAGGTAGAGGG - Intergenic
964588817 3:158337807-158337829 AAGTGGTTCATGAGGGTATAAGG - Intronic
965047346 3:163596845-163596867 ATTTTGTCCTTGTGGGTAGTTGG - Intergenic
965457688 3:168924344-168924366 ATTAGGGTCTTCAGGGGAGAAGG - Intergenic
966434392 3:179867142-179867164 ATTTGGTAGTTGAAGGGAGATGG - Intronic
966943939 3:184764439-184764461 ATTTGCTTTTTGGGGGAAGAAGG + Intergenic
967000032 3:185325568-185325590 ATTTGGTTTTGGGAGGTAGAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967450595 3:189618559-189618581 CCTCTGTTCTTGAGGGTAGAGGG + Intergenic
967497767 3:190161330-190161352 ATTTGGTTCATGAGGCTTGTTGG - Intergenic
970379769 4:15495075-15495097 ATTGGGTATTTGAGGGTGGAGGG - Intronic
972059961 4:34857123-34857145 GGTTGGTTTTTGATGGTAGAGGG + Intergenic
976524285 4:86068857-86068879 AGTTGGTTCTTCAGAGTAGATGG - Intronic
980782059 4:137503653-137503675 ATTTGGTTATGGAGTGTAGGAGG + Intergenic
981141537 4:141275209-141275231 ATTTGGTTGTGGAGAGTAGAAGG - Intergenic
983610072 4:169632800-169632822 GTTTGTTTCTTAAGGGTAGCAGG + Intronic
984131896 4:175886531-175886553 ATTTGATTCTGGACCGTAGAAGG - Intronic
986994610 5:13592749-13592771 ATTTACTTCTGGAGGGGAGAAGG - Intergenic
988913327 5:35868294-35868316 ATTTTCTTTTTGAGGGTTGAAGG - Intronic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
995367421 5:111378485-111378507 ATTTGGATCTTTAGGTGAGAAGG + Intronic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
1000135472 5:158345388-158345410 ATTTGGTTCTTATGGGGATATGG + Intergenic
1000790433 5:165600347-165600369 ATTTTGTACCTGAGGGTGGAAGG - Intergenic
1001248936 5:170130798-170130820 ATATGCTTTTTGAGGGTATATGG + Intergenic
1004516640 6:16327070-16327092 CTTTTGTCGTTGAGGGTAGAAGG + Exonic
1005579549 6:27220738-27220760 ATTTAGTTTTTGAGGGTGGCAGG + Intergenic
1007193002 6:40036024-40036046 ATTGGGTTCTTGAGGGGAATGGG - Intergenic
1008580505 6:52902591-52902613 ATTTCGTTTTTGAGGTTAGCAGG - Intronic
1010114086 6:72280794-72280816 ATTTGTTTCTTGAAGGCAAAGGG - Intronic
1010236328 6:73577877-73577899 ATCTGGGCCTTGAAGGTAGATGG + Intergenic
1010582757 6:77619745-77619767 ATTTGGTACATGAAGGGAGATGG - Intergenic
1010644238 6:78367780-78367802 TGTGGGTTCTTTAGGGTAGAGGG + Intergenic
1012573569 6:100762157-100762179 ATTTTTTGCTTGAGGATAGAGGG - Intronic
1012665394 6:101962035-101962057 CTTGGGTTCATGAGGGCAGAGGG + Intronic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1014937884 6:127405184-127405206 GTTTGGTTCTTGAGAATGGAAGG - Intergenic
1016027611 6:139303413-139303435 ATTAGGTTCCTGAGGGAATAAGG + Intergenic
1016963056 6:149691910-149691932 ATATGGTGCGTGATGGTAGAAGG - Intronic
1017056712 6:150443277-150443299 ATTTTTTTTTTGAGGGTGGATGG - Intergenic
1024320835 7:48067644-48067666 ATCTGGTTCTTGATCTTAGAGGG - Intergenic
1031164798 7:118214930-118214952 ATATGTTTCTTGAAGGTAAAGGG + Intronic
1031608925 7:123801949-123801971 TTTTGTTCCTAGAGGGTAGAGGG + Intergenic
1031616777 7:123890700-123890722 CTTTGGTTTTTGAGCGTAGCAGG + Intergenic
1035640095 8:1178256-1178278 ATTTGGTGGGTGAGGTTAGAGGG + Intergenic
1037686273 8:21142101-21142123 AGATGGTGCTAGAGGGTAGAGGG + Intergenic
1039514818 8:38123872-38123894 ATTTGTTTTTTGAGGCTAGAAGG + Intronic
1040792085 8:51243265-51243287 ATCTGGACTTTGAGGGTAGAAGG + Intergenic
1041857960 8:62479592-62479614 TTTTGGTTTCTGAGGGCAGAGGG + Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043627764 8:82284578-82284600 ATTAGGTTCTTGAGGGTGTTTGG + Intergenic
1043627797 8:82285188-82285210 ATTAGGTTCTTGAGGGTGTTTGG + Intergenic
1045373968 8:101552851-101552873 GTTTTGTTCTTGAGAGGAGATGG + Intronic
1046603072 8:116340358-116340380 GTTTGGTTCATGAGGATGGATGG + Intergenic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1048403335 8:134093262-134093284 ATTTGGTTATTGAGGGAATGGGG + Intergenic
1048593927 8:135846575-135846597 ATTTGGTTCCTGATGATAGCTGG + Intergenic
1048610800 8:136020790-136020812 ATTTGTTTGTTGACTGTAGAAGG + Intergenic
1049754571 8:144304130-144304152 ATTTGGGAATTGAGGGGAGAAGG + Intronic
1050195430 9:3078137-3078159 ATTTGGTTGTTGTGGGGAAAGGG + Intergenic
1051135407 9:13914606-13914628 ATGTGGTTCTTGAGGGACCAAGG - Intergenic
1051385231 9:16500651-16500673 ATTTAGTTTTTCAGGGTGGATGG + Intronic
1052004250 9:23327294-23327316 TTTTGGTTCTGCAGAGTAGATGG - Intergenic
1052383105 9:27793180-27793202 ATTTGCTTATTGGGGGTACAGGG + Intergenic
1056552372 9:87663005-87663027 AATTGCTTCTGGAGGGTAGGAGG - Intronic
1057237781 9:93378945-93378967 GTTTGTTTCATTAGGGTAGATGG - Intergenic
1060100606 9:120837310-120837332 ATTCGGTTCTTCAGGCTAGGTGG - Intronic
1060557672 9:124517462-124517484 ATTTGGTCATGGAGGGTTGATGG + Exonic
1186851160 X:13581355-13581377 CTCTGTTTCTTGATGGTAGATGG + Intronic
1188536950 X:31207705-31207727 ACTGGGGTCTTGAGGGTGGAGGG + Intronic
1189044365 X:37574565-37574587 ATTTGTTTCTTAGAGGTAGATGG - Intronic
1190012824 X:46799906-46799928 ATTTGGTTCTTTCAGGTGGAGGG + Intergenic
1194431232 X:93809037-93809059 ATTTGGTTCGTGATGGTTCATGG + Intergenic
1194970431 X:100337283-100337305 ATTTGGTTCTTGAGGCAATTTGG - Intronic
1195290584 X:103429023-103429045 AACTGGTTCTTGAGGGTAGAGGG - Intergenic
1195388971 X:104341284-104341306 ATGTGATTCTTGAGGATAGAGGG + Intergenic
1196866617 X:120076781-120076803 TTTTGGTTCAGGAGGGGAGAGGG + Intronic
1196876482 X:120159500-120159522 TTTTGGTTCAGGAGGGGAGAGGG - Intronic
1199278680 X:145974631-145974653 ATCTTGTTCTTGTGGTTAGATGG - Intergenic
1199366591 X:146992867-146992889 ATTTGGTTTTCAAGGGTGGAGGG - Intergenic
1199592072 X:149476791-149476813 GTTGAATTCTTGAGGGTAGATGG - Intergenic
1201912963 Y:19152149-19152171 ATTTGGTTCTTGGTGGTTGTTGG + Intergenic