ID: 951954990

View in Genome Browser
Species Human (GRCh38)
Location 3:28243699-28243721
Sequence CCTAGGGTCCAGAACAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951954990_951954996 -6 Left 951954990 3:28243699-28243721 CCCATATTGTTCTGGACCCTAGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG 0: 1
1: 0
2: 1
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951954990 Original CRISPR CCTAGGGTCCAGAACAATAT GGG (reversed) Intronic
901537139 1:9889854-9889876 TCTAGGGTCCACAAAAATATTGG - Intronic
907916421 1:58873922-58873944 CCCAGTGTCTAGAACAATGTTGG + Intergenic
910736175 1:90460071-90460093 CCTAAGGCCCAGAACAAAATAGG + Intergenic
911482205 1:98458316-98458338 CCTAGGGGCAAGAAAAATAAGGG + Intergenic
912178937 1:107194195-107194217 CCCAGAGCCCAGAGCAATATAGG - Intronic
913393115 1:118336189-118336211 ATTAGGGTCCAGAACAAGAAAGG - Intergenic
920707916 1:208268240-208268262 CCTATGGACCAGATCAATCTTGG + Intergenic
921331653 1:214044511-214044533 CCTAGGCTCCAGAATAAGAGTGG + Intergenic
922560321 1:226564982-226565004 CCTCGGGTCCAGAGCAGGATAGG - Intronic
1068867783 10:61913456-61913478 CCTAAGGCCCAGAAAAATCTTGG + Intronic
1077473228 11:2774582-2774604 CCTGGGGTCCAAAACAATGTTGG + Intronic
1079283305 11:19107187-19107209 CCTTGGTCCCATAACAATATTGG + Intergenic
1083037947 11:59657653-59657675 CCCAGGGTCCAGAAGATGATCGG - Exonic
1088194536 11:107260384-107260406 TCTAGTGTCCAGCACAATATGGG - Intergenic
1089875420 11:121716802-121716824 CCCAGAGTCCTGATCAATATGGG + Intergenic
1096784034 12:54007023-54007045 CCTAGGGTCCAGAACAGTAGGGG - Intronic
1098013893 12:66083801-66083823 CCTGGGAACAAGAACAATATGGG - Intergenic
1100185399 12:92133563-92133585 CCAAGTGCCCAGAACAATACTGG + Intronic
1111760707 13:92460854-92460876 CCTAGGATCTAGAACAACCTAGG - Intronic
1120112261 14:80571161-80571183 CTAAGGGACCAGCACAATATAGG - Intronic
1128919544 15:71597967-71597989 CCTAGGGCCCAGCACAGGATTGG - Intronic
1129927364 15:79376624-79376646 CCTAGGTTCCAGAACAAAGGAGG - Intronic
1138560987 16:57801048-57801070 CCAAGTGTTCAGAACAATACTGG + Intronic
1138980231 16:62259078-62259100 CCTTGGGTCCATAAAACTATAGG + Intergenic
1144255249 17:13461193-13461215 CCTAGTGCCCAGCACAGTATGGG + Intergenic
1147163685 17:38582123-38582145 CCTAGGGCTCAGGACAACATTGG + Intronic
1147537916 17:41332911-41332933 CCAGGGATCCAGGACAATATAGG + Intergenic
1148785746 17:50145415-50145437 CCTGGGCTCCAGAACTATAAGGG - Intronic
1149138193 17:53395760-53395782 TCTGGGGTCTAGAACAAGATAGG + Intergenic
1149921428 17:60663484-60663506 CTTAGGGGCCAGAAGAAAATTGG + Exonic
1157666388 18:49491174-49491196 CCTAGTGTGCAGATCAAGATGGG - Intronic
1159916390 18:74191731-74191753 CCAAGGGGCCAGAGCAATGTGGG + Intergenic
1162185663 19:8903010-8903032 CCTAGGGTCTGGTACAATGTAGG + Intronic
1162225945 19:9222865-9222887 TCTAGGGTCCAGAACAAGAAAGG - Intergenic
1166020579 19:40025006-40025028 CCCAGGGTCCAGAAAATGATTGG - Intergenic
925935924 2:8759642-8759664 CCTAGGTTCAAGTACAATACTGG + Intronic
931643879 2:64404416-64404438 CCCAGAGTCAAGAACAATAAAGG - Intergenic
932629196 2:73323821-73323843 CCTACGGTCGAGGACAACATGGG + Intergenic
936256138 2:110914738-110914760 CCTGAAGTCAAGAACAATATAGG - Intronic
937079931 2:119133567-119133589 CCAAGGGTCAAGAACAAAACAGG - Intergenic
941167062 2:162093875-162093897 CCTAGGTTACAGAACAGTAGGGG - Intergenic
942205936 2:173620143-173620165 CACAGGGTCCAGAATATTATGGG + Intergenic
945412699 2:209530878-209530900 ACTAGGAAACAGAACAATATGGG - Intronic
1178331066 21:31691886-31691908 CCTATGAACCATAACAATATAGG + Exonic
951954990 3:28243699-28243721 CCTAGGGTCCAGAACAATATGGG - Intronic
953776167 3:45819309-45819331 CCAAGGGTTCAGAAGAATCTGGG - Intergenic
958926665 3:100165205-100165227 CAAAGGCTCCACAACAATATAGG + Intronic
960586840 3:119327781-119327803 CCCAGAGCCTAGAACAATATTGG + Intronic
968673225 4:1863526-1863548 CCTAGGCTCCAGAACGATGAGGG + Intergenic
969137100 4:5038236-5038258 CCTTGCCTCCAGAACGATATAGG - Intergenic
975748510 4:77498027-77498049 TCTAGTGTCCATAACATTATAGG - Intergenic
977919890 4:102631417-102631439 ATTAGGGTCCAGCACAGTATTGG + Intergenic
983257438 4:165416375-165416397 CCTAGGGGCCAGAGCATTAAGGG - Intronic
983989608 4:174101634-174101656 CCTAGGGTAAAGAAGAATTTTGG - Intergenic
988643796 5:33071300-33071322 GCTAGGGTTCAGAAAAACATGGG + Intergenic
989544163 5:42653404-42653426 CCTGGGGTTTAGAACAAGATAGG - Intronic
989995211 5:50820943-50820965 CATAGGGTCTAGAACAATACTGG + Intronic
999038647 5:148383033-148383055 CCTAAGGTGCCGAACCATATTGG + Intergenic
1001350396 5:170957291-170957313 CCTAACCTCCAGAAAAATATTGG - Intronic
1005884808 6:30089160-30089182 CCTAGAGGCAAGAACAATTTGGG + Intergenic
1005884973 6:30090727-30090749 CCTAGAGGCAAGAACAATTTGGG - Intergenic
1012972350 6:105744827-105744849 CCTAGGGTCTAAAACAACTTAGG + Intergenic
1020262015 7:6536111-6536133 CCTAGAGGCCAGCACACTATGGG + Intronic
1027689535 7:81325768-81325790 CCTAGTATCCAGAAAAAAATAGG - Intergenic
1033483141 7:141761351-141761373 CACAGGGTCCAGCACAAAATTGG - Intronic
1039491258 8:37949184-37949206 CATTGGGTCCAGCAGAATATGGG - Intergenic
1042464652 8:69113954-69113976 TCTAGTGTCCAAAACAATCTTGG + Intergenic
1044853818 8:96454286-96454308 CCCAGGGCCCAGCACAGTATTGG - Intergenic
1048374391 8:133810201-133810223 ATTAGGGTCCAGAGCAATTTTGG - Intergenic
1051217537 9:14814650-14814672 CTCAGGGTCAAGAACAATACTGG - Intronic
1052322432 9:27182705-27182727 CCTATGGTTCAGAATAAAATTGG + Intronic
1057514533 9:95710400-95710422 CCTAGGATCCAGACCAGTGTGGG + Intergenic
1057993566 9:99798537-99798559 CCTAGCTCCCAGAACAACATAGG + Intergenic
1058511306 9:105721227-105721249 CTTAGCTTCTAGAACAATATAGG + Intronic
1187718705 X:22130020-22130042 CCTAGGCTTCAGAAAGATATTGG - Intronic
1189520003 X:41757030-41757052 CCCATGTTCCAGAACCATATAGG + Intronic